ID: 999679624

View in Genome Browser
Species Human (GRCh38)
Location 5:154044524-154044546
Sequence CAGTATTAACTGGATGTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999679619_999679624 16 Left 999679619 5:154044485-154044507 CCTCTGTGTTCAGGATGTACATG 0: 1
1: 0
2: 1
3: 12
4: 167
Right 999679624 5:154044524-154044546 CAGTATTAACTGGATGTGTAAGG 0: 1
1: 0
2: 1
3: 11
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999679624 Original CRISPR CAGTATTAACTGGATGTGTA AGG Intronic
903314595 1:22492219-22492241 CAGTATAAACTCAGTGTGTAAGG - Intronic
905059843 1:35130557-35130579 CAGTGTTAACAGGGTGTGGAAGG - Intergenic
909171079 1:72296631-72296653 CAGTTTTAATTGGATTTATAAGG + Intergenic
910557043 1:88545641-88545663 CAGCATTTTCTGGATGTGTATGG - Intergenic
910744629 1:90560215-90560237 CAGCATTACCTGGAATTGTAGGG + Intergenic
911277298 1:95878184-95878206 CAGTGTTAACTTGATATGTTAGG + Intergenic
912577120 1:110682998-110683020 CAGTGTTAACTGGATCATTATGG - Intergenic
913478448 1:119261439-119261461 CTGTATTAGCTGAATCTGTAAGG - Intergenic
917750242 1:178046366-178046388 CAGTATTAAATGGCTGTGTCAGG - Intergenic
924178301 1:241415620-241415642 CAGAATTAACTGAATATGAAAGG - Intergenic
1065823397 10:29548025-29548047 TAGTTTTAACTGGAAATGTAGGG - Intronic
1066328476 10:34391535-34391557 CTGAATTAAATGGATGAGTATGG + Intronic
1076275482 10:129195152-129195174 CAATATTAACTGTGTGTGTAAGG + Intergenic
1076985260 11:231574-231596 TAGTATTAACTGGTTCTGAAAGG + Intronic
1077102004 11:826480-826502 CAGTATTCAGTGTATATGTATGG - Intronic
1079474896 11:20819886-20819908 CACTATTAACTGTAGTTGTATGG + Intronic
1086837990 11:91649708-91649730 CATTATTAACTGGATGTCTGAGG + Intergenic
1087032713 11:93722037-93722059 CCTTATTACCTGGATCTGTAAGG - Exonic
1087348233 11:96998749-96998771 CAGTTTTGATTGCATGTGTATGG - Intergenic
1087543857 11:99558659-99558681 CAGTATTAGCTGGAAATCTAGGG - Intronic
1089072278 11:115709992-115710014 GAGTATTGACTGCATGTGTCAGG + Intergenic
1091628356 12:2139810-2139832 CAGTGTGAACTGGAGGTGTAAGG + Intronic
1093587434 12:20856844-20856866 TAGTATTGCCTGGATGTGGAGGG - Intronic
1095245651 12:39918103-39918125 CAGTATTATCTAGATGTACAAGG - Intronic
1095294554 12:40513415-40513437 CAGTAGTAACTGGATGTCAAAGG - Intronic
1099019555 12:77386487-77386509 CAGTATAAACTTTATGTGTTAGG + Intergenic
1100153212 12:91767192-91767214 CAGAATAAAGTGCATGTGTATGG + Intergenic
1106211732 13:27654781-27654803 CATTTTTAACTGGAAGTGCATGG + Intronic
1106454408 13:29914191-29914213 CAGAATTCACTGGATGTGACTGG - Intergenic
1107142927 13:37022797-37022819 CAGGATAAACTTGATGTGTTAGG - Intronic
1121222287 14:92295287-92295309 CAGTCTAAACTGGAGATGTATGG - Intergenic
1124434703 15:29637495-29637517 CATGAATAACTGGATGTGTGAGG + Intergenic
1131828356 15:96337589-96337611 CAGTTTTAACTGGCCGTATATGG + Exonic
1132636362 16:951751-951773 CAGTCTTCACTGGAGGTGTGAGG - Intronic
1134780623 16:16891932-16891954 CAGTATTACATGGGTGTGGATGG - Intergenic
1140058657 16:71548109-71548131 CTGTCTTATCTGGATCTGTAAGG - Intronic
1140438876 16:74971367-74971389 CAGTATAAAGTGTATGGGTAAGG - Intronic
1140824868 16:78696429-78696451 CGGTTTCTACTGGATGTGTATGG - Intronic
1142907903 17:3058875-3058897 CAATTTTAACTGTATGTGAAAGG - Intergenic
1142926660 17:3245391-3245413 CAATTTTAACTGTATGTGAAAGG + Intergenic
1145071776 17:19815984-19816006 AAGTATTAGCTGGGTGTGGAAGG - Intronic
1146670726 17:34735794-34735816 GAGTATTAAGTGGATGAGGATGG + Intergenic
1149900815 17:60476070-60476092 CTGTATTTTCTGGATGTGTTTGG + Intronic
1150138809 17:62711741-62711763 CAGTACAAGCTGGATGTGTCGGG + Intronic
1150487098 17:65551422-65551444 CTGTCTTAACTGGATGGGGAGGG + Intronic
1157088248 18:44604561-44604583 CATTATTAACTGGAGGTGCCAGG - Intergenic
1158126382 18:54103832-54103854 CACTATAGACTGGATGTGTGGGG + Intergenic
1159389324 18:67768587-67768609 CAGTTTTAAATGTGTGTGTATGG - Intergenic
1160280297 18:77484009-77484031 CAGTATTAACATGATGTGAAAGG + Intergenic
1160317980 18:77865980-77866002 CAGTCTTGTCTGGATGTGTCCGG + Intergenic
1160922422 19:1527133-1527155 CAGTATGAACAGGACGTGTGTGG + Intronic
928977014 2:37098422-37098444 CAGTATTGACTGGAATTGCAAGG - Exonic
929241353 2:39656977-39656999 CAGTGTTAACTGGGTTTATAGGG - Intergenic
931353155 2:61510543-61510565 CATTCTTAAATGGATGTTTATGG + Intronic
936872630 2:117150762-117150784 CAGTAGTAACTGAAAGTGTTAGG - Intergenic
936926980 2:117747218-117747240 CAGTATTAACTGAATTGGTAAGG - Intergenic
942749459 2:179271109-179271131 CAGTATTATCTGTATGTGTGTGG + Intergenic
943992692 2:194717331-194717353 CAGTTTCAACTGAATGTGTATGG - Intergenic
1169502602 20:6175456-6175478 CAGTAGTAACAGGATTTCTAAGG - Intergenic
1174756678 20:53165875-53165897 CAGTGTTAAGTGGCTGTGCAAGG - Intronic
1177165496 21:17598576-17598598 CAGTTTTAAAGGGATGTGCAGGG - Intronic
1180653267 22:17396912-17396934 CAGAATTAACTGCATGTGGTTGG + Intronic
949745623 3:7288995-7289017 CAGTCTTACCTGCATGTATATGG - Intronic
957888252 3:86319194-86319216 AAGAATTAAGTGGATGGGTAGGG + Intergenic
962286333 3:134088163-134088185 CAGTTTTAACAGGATCTGTCTGG + Intronic
966810455 3:183839315-183839337 AAGTACAAACTGAATGTGTAAGG + Intronic
971076333 4:23153432-23153454 CATTTTTAACTGGATGGGAAAGG - Intergenic
978202178 4:106035027-106035049 CAGGATTAACTGTGTTTGTAGGG + Intergenic
980743811 4:136989231-136989253 AAGCAATAACTGAATGTGTAGGG - Intergenic
983518039 4:168677811-168677833 CAGGATTAACTGGCGGAGTAGGG - Intronic
983638740 4:169924686-169924708 CAGTTTTCGCTGGATGTCTAGGG + Intergenic
986333017 5:6731767-6731789 CAGATTTCACTGGATGTTTAAGG - Intronic
992915071 5:81441431-81441453 CTGTCTTAACTGTAAGTGTAAGG - Intronic
994430093 5:99647624-99647646 CAGTATTACTTGTATGAGTATGG - Intergenic
995924904 5:117359567-117359589 CAGATCTAACTGGATGTGTGTGG - Intergenic
996713261 5:126564446-126564468 CAGTAATAAATGTATGTCTAAGG - Intronic
997931492 5:138076070-138076092 CAGTTATTTCTGGATGTGTAAGG - Intergenic
999096451 5:148982234-148982256 CATTAGTAACTGGCTGTGTTGGG + Intronic
999679624 5:154044524-154044546 CAGTATTAACTGGATGTGTAAGG + Intronic
1000983323 5:167840417-167840439 CAGTTATAACAGGATCTGTATGG - Intronic
1002630831 5:180576058-180576080 GATTATAAACTGGATGTGTTTGG - Exonic
1003147573 6:3521596-3521618 CTGTATTACCAGGCTGTGTAAGG - Intergenic
1013496211 6:110700091-110700113 CATTATGAACTGCATGTGCAAGG + Intronic
1015342601 6:132118917-132118939 CTGTATTGATTGGATGTGTGAGG + Intergenic
1021879382 7:25079055-25079077 AAGTATTAACTGGATGTTACAGG + Intergenic
1022402679 7:30055469-30055491 CAGTTTTAACTGTATGTGTCTGG - Intronic
1026202724 7:68229017-68229039 CAGGAAGACCTGGATGTGTATGG + Intergenic
1030305950 7:108018977-108018999 CAGTATTATCTTCATGTGCATGG + Intergenic
1030611342 7:111692897-111692919 TAACATTAACTGGATGTCTATGG - Intergenic
1031046442 7:116893597-116893619 CAGTATTAACTGAATGTATAAGG - Intronic
1039088859 8:33806684-33806706 CAATATTAAAATGATGTGTATGG + Intergenic
1041225178 8:55690483-55690505 CAGTTTGAACTTCATGTGTATGG + Intergenic
1042637214 8:70891429-70891451 CAGTATTAAGAGGAAGTTTATGG - Intergenic
1044630697 8:94275789-94275811 CACTAGTAACTGGATGTTTTAGG - Intergenic
1057894483 9:98896736-98896758 CAGTCTCAACTGAATGTCTAGGG - Intergenic
1058278423 9:103077862-103077884 CAGAATTAACTGTGTGTTTATGG - Intergenic
1060706506 9:125806602-125806624 CAGTATTAACAGGCTTTGGAAGG - Intronic
1185965400 X:4594831-4594853 AAGTATTATCTGGAAATGTAAGG + Intergenic
1188328695 X:28840824-28840846 CAGTAGTAACTGGAGCTGTGGGG + Intronic
1189021490 X:37346469-37346491 CAGAATTAACTGGATCAGGATGG - Intergenic
1189132580 X:38515858-38515880 TTTTATTAACTGTATGTGTATGG + Intronic
1194424257 X:93717369-93717391 CAGAATTAACTGGACTTATATGG - Intergenic
1195591192 X:106629008-106629030 TATTATTTGCTGGATGTGTATGG + Intronic
1197053589 X:122091194-122091216 CAGTATTAAGAGGATTTTTAGGG - Intergenic
1201765585 Y:17571058-17571080 CAGGATTAACTGAATGAGTGTGG - Intergenic
1201835967 Y:18334931-18334953 CAGGATTAACTGAATGAGTGTGG + Intergenic
1202026807 Y:20532781-20532803 CATTATTAGCTTGATGTGGATGG - Intergenic