ID: 999684270

View in Genome Browser
Species Human (GRCh38)
Location 5:154088453-154088475
Sequence CCCCACACTCAGCTTTCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 169}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999684267_999684270 -10 Left 999684267 5:154088440-154088462 CCAGAAGGGCTGCCCCCACACTC 0: 1
1: 0
2: 1
3: 9
4: 208
Right 999684270 5:154088453-154088475 CCCCACACTCAGCTTTCTACAGG 0: 1
1: 0
2: 0
3: 20
4: 169
999684265_999684270 1 Left 999684265 5:154088429-154088451 CCTTCTCCACACCAGAAGGGCTG 0: 1
1: 0
2: 0
3: 21
4: 243
Right 999684270 5:154088453-154088475 CCCCACACTCAGCTTTCTACAGG 0: 1
1: 0
2: 0
3: 20
4: 169
999684263_999684270 4 Left 999684263 5:154088426-154088448 CCTCCTTCTCCACACCAGAAGGG 0: 1
1: 0
2: 2
3: 19
4: 251
Right 999684270 5:154088453-154088475 CCCCACACTCAGCTTTCTACAGG 0: 1
1: 0
2: 0
3: 20
4: 169
999684258_999684270 8 Left 999684258 5:154088422-154088444 CCCCCCTCCTTCTCCACACCAGA 0: 1
1: 0
2: 8
3: 72
4: 662
Right 999684270 5:154088453-154088475 CCCCACACTCAGCTTTCTACAGG 0: 1
1: 0
2: 0
3: 20
4: 169
999684260_999684270 6 Left 999684260 5:154088424-154088446 CCCCTCCTTCTCCACACCAGAAG 0: 1
1: 0
2: 2
3: 30
4: 338
Right 999684270 5:154088453-154088475 CCCCACACTCAGCTTTCTACAGG 0: 1
1: 0
2: 0
3: 20
4: 169
999684266_999684270 -5 Left 999684266 5:154088435-154088457 CCACACCAGAAGGGCTGCCCCCA 0: 1
1: 1
2: 1
3: 28
4: 245
Right 999684270 5:154088453-154088475 CCCCACACTCAGCTTTCTACAGG 0: 1
1: 0
2: 0
3: 20
4: 169
999684257_999684270 15 Left 999684257 5:154088415-154088437 CCAGGATCCCCCCTCCTTCTCCA 0: 1
1: 0
2: 4
3: 36
4: 492
Right 999684270 5:154088453-154088475 CCCCACACTCAGCTTTCTACAGG 0: 1
1: 0
2: 0
3: 20
4: 169
999684261_999684270 5 Left 999684261 5:154088425-154088447 CCCTCCTTCTCCACACCAGAAGG 0: 1
1: 0
2: 0
3: 28
4: 282
Right 999684270 5:154088453-154088475 CCCCACACTCAGCTTTCTACAGG 0: 1
1: 0
2: 0
3: 20
4: 169
999684259_999684270 7 Left 999684259 5:154088423-154088445 CCCCCTCCTTCTCCACACCAGAA 0: 1
1: 0
2: 5
3: 68
4: 621
Right 999684270 5:154088453-154088475 CCCCACACTCAGCTTTCTACAGG 0: 1
1: 0
2: 0
3: 20
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999684270 Original CRISPR CCCCACACTCAGCTTTCTAC AGG Intronic
901393298 1:8962500-8962522 CCAGCCACTCAGCTTTCTAGCGG - Intronic
902217186 1:14941599-14941621 CCCCAGAATTAGCTTTCTGCAGG + Intronic
903166738 1:21525428-21525450 TCCTCCACTCAGCTTTCTCCAGG - Intronic
904405622 1:30286347-30286369 CCCCAGACTCAGATTCCAACCGG + Intergenic
904458609 1:30662311-30662333 CCCCAGACTCAGATTTCAACCGG + Intergenic
904873666 1:33636991-33637013 CCCCACACTCAGCAGCCTCCTGG + Intronic
906573466 1:46865203-46865225 CCCAACTCTCAGCTTTAGACAGG + Intergenic
907057006 1:51378873-51378895 CCCCACACTAATCTTTATACCGG + Intronic
908171525 1:61509983-61510005 CCCCACCCACAGCTTTCTTGAGG - Intergenic
909245190 1:73271983-73272005 TTCCATCCTCAGCTTTCTACAGG + Intergenic
910633415 1:89380994-89381016 CACCACCCTCAGCCTTCTAGAGG - Intronic
911432281 1:97806416-97806438 GCACACTCTCAGGTTTCTACTGG + Intronic
918144326 1:181742332-181742354 CCCCACATTTGGCTTTCTGCTGG - Intronic
918997548 1:191781708-191781730 CCACACACTGAGCTCTCTCCTGG + Intergenic
920077854 1:203350147-203350169 CTTCAGACTCAGCTTTCTAGGGG + Intronic
920094913 1:203480289-203480311 CTCCACCCACAGCTTTCTACTGG - Intronic
920282389 1:204853920-204853942 CCCCACAATCAGCTCTCTTGTGG - Intronic
921838757 1:219806213-219806235 CCCAACACACAGCTTTCTGGTGG + Intronic
922226634 1:223651104-223651126 ACCCACACTCAGTGTCCTACTGG - Intronic
923203574 1:231736157-231736179 CCTGACACTGAGCTTTTTACTGG + Intronic
923368649 1:233288375-233288397 CCCCACTCCCAGCTTTCTCAGGG - Intronic
924545324 1:245020916-245020938 CACCACACCCAGCCTTATACTGG + Intronic
1064186072 10:13162727-13162749 CCACACACTGTGCTATCTACTGG - Intronic
1070047748 10:72855833-72855855 CCCAACTATAAGCTTTCTACAGG + Intronic
1072800145 10:98387091-98387113 CTCCATACTCAGCTTTCATCAGG - Intronic
1073080568 10:100857680-100857702 ACCCATATTCAGCTGTCTACTGG + Intergenic
1073165606 10:101446957-101446979 CCCCAGACTCTGCTTTCAAGAGG - Intronic
1075466573 10:122655847-122655869 CCCCTCATTCATCTTTCTTCAGG - Intergenic
1075643027 10:124078872-124078894 CCCTTCACTCAGCTTCCCACAGG - Intronic
1077759890 11:5083145-5083167 CACCACACTCAGCTTATTAAGGG - Intergenic
1078161752 11:8846264-8846286 TACCACACTCAGCCTTCTTCTGG - Intronic
1078198178 11:9154290-9154312 CCCAACACTCTGCTTACTAACGG - Intronic
1078982833 11:16557407-16557429 TCCCACATTCAACTTTCTTCTGG + Intronic
1084390814 11:68875549-68875571 CCCCATACACAGCTGTCAACTGG - Intergenic
1089174206 11:116536588-116536610 CCCCTCACTCAGCTGGCTCCTGG + Intergenic
1093075321 12:14752212-14752234 CACCACACCCAGCTATTTACAGG - Intergenic
1093952198 12:25175789-25175811 CACCACACCCAGCCTTCTATTGG - Intronic
1097183706 12:57185195-57185217 CCCCAGCCTCACCTTTCTGCCGG - Exonic
1097246570 12:57610682-57610704 CCCCACCCCCAGCTTCTTACCGG - Exonic
1098634447 12:72764513-72764535 CTCCACACTCAGCTATATCCAGG + Intergenic
1101089916 12:101274713-101274735 CTACACACTGAGCTTTCCACAGG + Intergenic
1101136364 12:101747802-101747824 CCCAACACTCTGCTCTCTACTGG - Intronic
1102486973 12:113265224-113265246 CCACACAGTCAGCTCACTACAGG - Intronic
1104390550 12:128387915-128387937 CCCCAGACCCAGCTTGCTCCTGG + Intronic
1108057514 13:46499208-46499230 ACCCAAGCTCAGCTTCCTACTGG - Intergenic
1109252815 13:60040790-60040812 CCCCACACCCAACATACTACTGG + Intronic
1111351679 13:87039106-87039128 TCTCACACTCAGGTTTCTCCTGG - Intergenic
1113783965 13:112992590-112992612 CTTCAAACTCAGCTTCCTACAGG - Intronic
1121433339 14:93902919-93902941 CCCCACACTCACCCTTGTCCAGG + Intergenic
1124504435 15:30261173-30261195 CCCCACACTAAACTGTCTACTGG - Intergenic
1124739116 15:32277462-32277484 CCCCACACTAAACTGTCTACTGG + Intergenic
1125212724 15:37236160-37236182 CGCCACACTCTACTTTCTAAAGG + Intergenic
1128380189 15:67106698-67106720 CCCCACACACAGCTTCCTTTGGG + Intronic
1130295821 15:82646841-82646863 CCCCACACTCAGGTGACTCCAGG + Intronic
1130371531 15:83288771-83288793 CCCCCCACGCAGCTGTCTGCTGG + Intergenic
1131552063 15:93365627-93365649 CCCCACTCCCAGCTGTCTCCTGG - Intergenic
1131775358 15:95790359-95790381 CCGCACACTCAGCTTTCAGCTGG + Intergenic
1132385988 15:101400253-101400275 TCCCCCACTGAGCTTTATACAGG + Intronic
1136456256 16:30381463-30381485 CCCCACACCCAGCTGGCTTCCGG - Exonic
1137410068 16:48220964-48220986 CTCCAAACCCAGCCTTCTACTGG - Intronic
1141067362 16:80924883-80924905 CCCCAGAATCAGCTTTCAGCTGG + Intergenic
1142044981 16:87919528-87919550 CCCCAGACTCTGCTTTCCCCAGG - Intronic
1142088203 16:88195790-88195812 CCCCACCCTGAGCTGTCTCCAGG + Intergenic
1146005006 17:29155502-29155524 CCTCCCACTCAGATTTCTGCAGG - Intronic
1146647548 17:34585093-34585115 TCCCACACCCATCTTTCTTCTGG + Intronic
1149099363 17:52884836-52884858 CCCCACATTCTTATTTCTACAGG + Intronic
1153160573 18:2200202-2200224 CTCCAGAATCAGCTTTCTAAAGG - Intergenic
1155398675 18:25415205-25415227 CACCACACTCAGCTGTTGACAGG - Intergenic
1157474917 18:48017345-48017367 CTCCGCACTCAACTTCCTACTGG - Intergenic
1160981512 19:1818585-1818607 CCCCACCCACAGCTTCCTGCAGG - Exonic
1161331891 19:3692498-3692520 CCCCACACTCAACCTTCAAAAGG + Intronic
1167293504 19:48636759-48636781 CCCCGCACGCAGGTTTCTATGGG + Intronic
1167507467 19:49878347-49878369 TCCCACACCCAGCCTTCTTCAGG - Intronic
925147022 2:1588457-1588479 CCCCCCACTCAGGTCTCCACCGG + Intergenic
925810874 2:7699155-7699177 TCTCACAATCAGCTTTCTTCAGG + Intergenic
926147690 2:10406643-10406665 CTCCACACCCAGATTTCCACCGG + Intronic
926593006 2:14759523-14759545 GCTCACATTCACCTTTCTACTGG - Intergenic
927241949 2:20927173-20927195 CCCAAGGCTCAGCTTCCTACAGG - Intergenic
927694932 2:25233184-25233206 TCCCACTCTCAGCTGTCCACGGG + Exonic
928186889 2:29118431-29118453 CCCCAAACTCTGATTTCTATAGG - Intronic
929610395 2:43266657-43266679 ACCCACACTAAGCTTTTTAAGGG - Intronic
933847608 2:86337895-86337917 CCCCACCCTCAGCGTTCCAGCGG + Intronic
935288401 2:101587625-101587647 CCCCACTCTCAGCATTGAACAGG - Intergenic
936152908 2:110031339-110031361 CACCACACCCACCTTTCCACAGG - Intergenic
936191772 2:110340073-110340095 CACCACACCCACCTTTCCACAGG + Intergenic
936494861 2:113009677-113009699 TCCCAAACTCAGGTTTCTCCAGG + Intergenic
937363685 2:121245872-121245894 GCACACACCCAGCTTTCTAAAGG + Intronic
937733586 2:125262444-125262466 CCCCACCCTCAGCTTTCCCAGGG + Intergenic
946391445 2:219419055-219419077 CCCCAGACTCCTCTTTCTGCGGG + Intronic
947034625 2:225838077-225838099 CCCCACACACACCTTTCTCTTGG + Intergenic
947098705 2:226595272-226595294 GACCACACTCAGGTTTCTAGTGG - Intergenic
948264170 2:236625362-236625384 CTCCACACTCAGCTCCTTACAGG - Intergenic
948691167 2:239706080-239706102 CCCCACACTCAGGGTTCTGATGG - Intergenic
1169955799 20:11101495-11101517 CCCCACAGTCCCCTTTATACTGG - Intergenic
1170109332 20:12787886-12787908 CCCCACATTCAGCCCTCTAAGGG + Intergenic
1170141754 20:13131931-13131953 CCCCTCGCTCAGCCTACTACAGG + Intronic
1170358684 20:15520614-15520636 CTCTACCCTCAGCTTTCCACAGG - Intronic
1171426533 20:25052031-25052053 CCCCACATGGAGCTTTCTTCAGG - Intronic
1171777960 20:29388307-29388329 CCCCACCCTCCACATTCTACTGG + Intergenic
1172215376 20:33232098-33232120 CCCCACGCTGACCTTTCTCCTGG + Intergenic
1172228079 20:33318475-33318497 CCCTACACTCAGCCTACAACTGG + Intergenic
1172688168 20:36772970-36772992 CCCCACAGACAGATTTCTGCTGG - Intronic
1173003273 20:39120933-39120955 GCCCACACTCAGCCTCCTACTGG + Intergenic
1175342904 20:58246112-58246134 GCCGACACACAGCTTTCCACAGG + Intergenic
1175502437 20:59460097-59460119 CCCTACACTCAGGCTTCTCCGGG + Intergenic
1176276710 20:64276306-64276328 TCCCACATTCAACTTTCTAAGGG + Intronic
1178362344 21:31958949-31958971 CTCCCCACTCAGCTCTCCACAGG + Exonic
1178592413 21:33922457-33922479 CACCACACTCAGCTTTAAAACGG + Intergenic
1180019752 21:45114948-45114970 CCCCATATCCAGCTCTCTACAGG - Intronic
1180756403 22:18164879-18164901 CCCTACTCCCAGCTTTCTCCTGG - Intronic
1181010067 22:20035060-20035082 CCCCACAGTCTGCTTCCCACAGG + Intronic
1181075366 22:20372555-20372577 CCCTACTCCCAGCTTTCTCCTGG + Intronic
1182069317 22:27452360-27452382 CCACCCACCCAGCTATCTACCGG - Intergenic
1182481902 22:30614583-30614605 CCCCACACTCACCTTTCCTTGGG + Intronic
1183070618 22:35393544-35393566 CCTTACACTCAGCTTTCTGGTGG + Exonic
1183744370 22:39684706-39684728 CCCCACACTCTGCTGTCCCCAGG - Intronic
1184071131 22:42147871-42147893 CCCCACATTCAGCATTGGACGGG + Intergenic
1184671155 22:46012922-46012944 CCCCACACTCAGCCTCCTTCTGG + Intergenic
950743587 3:15068882-15068904 CTGCACACTCAGCTCTCTAATGG + Intergenic
950834553 3:15906527-15906549 GCTCACACTCAGCTTCCTACTGG - Intergenic
952434104 3:33255109-33255131 CCCCATACTGAACTTTTTACTGG - Intergenic
952651465 3:35732364-35732386 CCTCAGACTCAGCTTTCAACAGG + Intronic
953680924 3:45037403-45037425 TCCCTCACTCAGCTTCCTAGCGG + Intergenic
961701925 3:128751180-128751202 CCCCACACAGAGCTCTCCACAGG + Intronic
963763049 3:149304676-149304698 CCCCACTTTCAGCTTTGGACAGG - Intergenic
964114939 3:153126356-153126378 CACCACACCCAGCTTGTTACTGG + Intergenic
964380103 3:156090038-156090060 CCCCTGAGCCAGCTTTCTACTGG - Intronic
964634695 3:158846169-158846191 CCCAACAGGCAGCTTTCAACTGG - Intergenic
967927657 3:194663883-194663905 CCCCATCCTCAGCTCTCTACGGG - Intronic
968455678 4:698116-698138 CACCACACGCAGCTTTCTGGTGG + Intergenic
971195357 4:24468172-24468194 CTCCACAGTCAGCTTTCTGATGG + Intergenic
972482730 4:39513132-39513154 ACCCTCACTCAGCTTCCAACTGG + Intronic
975319531 4:72994701-72994723 CCCCACCCTTAGCTCTCTTCAGG + Intergenic
975716191 4:77207776-77207798 CCCCTCCCTCAGCTTGGTACTGG - Intronic
977181339 4:93879025-93879047 CTCCACACTAACCTTTCTCCTGG + Intergenic
977242037 4:94584584-94584606 TCCCACACACAGCTTTCTTTAGG + Intronic
977361188 4:96008271-96008293 CCTCACACTCAGATTTTTGCTGG + Intergenic
979551954 4:122001553-122001575 CCCCACACTCAGCCTACTTTTGG - Intergenic
982108573 4:152032617-152032639 CCTCAAACTCTGCTTTCTCCAGG - Intergenic
982828023 4:160024537-160024559 CCCCACCCTCAGCATTGGACAGG - Intergenic
985011113 4:185583067-185583089 AACCAAACTCAGCTTTCTTCAGG + Intergenic
986941084 5:12950854-12950876 GCTCACACTCAACTTTCAACAGG - Intergenic
989392079 5:40911497-40911519 CCCCAAGCTCAGCTCTCTCCTGG - Intronic
998594574 5:143515519-143515541 TCCCAAGCTCAGCTTTCTTCTGG - Intergenic
998721522 5:144956877-144956899 CCCCACTCTCAGCATTGGACAGG - Intergenic
999577682 5:152997877-152997899 CCCCAAACTCAGCATGCTAAAGG + Intergenic
999684270 5:154088453-154088475 CCCCACACTCAGCTTTCTACAGG + Intronic
999883938 5:155899053-155899075 GGCCACACTAAGCTTTCTTCTGG - Intronic
1000388074 5:160694270-160694292 CCCCACCCTAAACTTTCTGCAGG - Intronic
1000506675 5:162128541-162128563 CTCCAAACTCAGCTTTCAGCAGG + Intronic
1000975996 5:167764965-167764987 CACCATACTCAGCTTGCTAAGGG - Intronic
1002054433 5:176590541-176590563 CCTCACACTCATCTTTCTCCAGG + Exonic
1006175148 6:32117025-32117047 CCCCACACTCACCTTTCTGGGGG + Exonic
1010750724 6:79613959-79613981 CCCCAAACTCACCTTCCTTCAGG - Intergenic
1014076623 6:117242877-117242899 ACCCTCACTCTGCTTTGTACAGG - Intergenic
1016008235 6:139111360-139111382 CCCCACAATCTGCTGTCTACAGG + Intergenic
1016969758 6:149750554-149750576 CCCCGCACGGAGCTTTCCACTGG - Intronic
1019522306 7:1466458-1466480 GCCCATGCTCAGCTTCCTACAGG + Intergenic
1024022365 7:45383769-45383791 CCTCACACTCAGCTTTATTGAGG + Intergenic
1026319975 7:69259830-69259852 GCCCACAGTCAACCTTCTACAGG + Intergenic
1028390097 7:90306094-90306116 CCCCATACCCAGCTTTTTATTGG + Intronic
1028827763 7:95293520-95293542 AGCCAAACTCAGCTTTCAACTGG + Intronic
1031235161 7:119166381-119166403 CCCCACTCTCAGCATTAGACAGG - Intergenic
1031332553 7:120483959-120483981 TCACACACTCAAATTTCTACAGG - Intronic
1034416336 7:150966143-150966165 CCCCACACACAGCTTGCCACAGG + Intronic
1034989861 7:155541636-155541658 CCCCACACTCAGCAGACTGCGGG - Intergenic
1035631734 8:1111976-1111998 CACCACACACTGCTTTCCACAGG + Intergenic
1038754060 8:30324558-30324580 ACCAACACTCATGTTTCTACTGG + Intergenic
1040943604 8:52857787-52857809 CCCTACACTCAGGTTTCTCAGGG - Intergenic
1043570475 8:81597051-81597073 ACACACACACAGCTTTCTCCAGG + Intergenic
1044856363 8:96480131-96480153 CCCAACACACAGCATTCTATGGG - Intergenic
1045796517 8:106051860-106051882 CTGCACACTCAGCTTTCTAATGG - Intergenic
1047175481 8:122536599-122536621 CCCCACCCTGAGCTTTCTAAAGG + Intergenic
1049913718 9:295827-295849 TCCCACCCTCATCATTCTACAGG + Intronic
1057144362 9:92748363-92748385 TCCCACACTCATCTTTCCCCTGG + Intronic
1057253202 9:93520659-93520681 CCACACACCCACCTTCCTACAGG - Intronic
1059367184 9:113795405-113795427 CCTCAGGCTCACCTTTCTACTGG - Intergenic
1060491845 9:124090988-124091010 GCTAACACTCAGCTTCCTACAGG - Intergenic
1061130463 9:128705272-128705294 CTCCACCCTCTGCTTTCCACCGG + Intronic
1061532086 9:131222402-131222424 CCCCACAGGCTGCTTTCTTCTGG - Intronic
1062429577 9:136521068-136521090 CTCCACACACAGCTGTCTCCTGG + Intronic
1186139164 X:6552871-6552893 CTCCAAACTCTGCTTTCTATGGG + Intergenic
1186535315 X:10341084-10341106 CCCTTCACTCTGCTTTCTGCAGG - Intergenic
1186781248 X:12914432-12914454 CCACATACTCAGCTGCCTACTGG + Intronic
1187963121 X:24585230-24585252 CCCTGCACTGAGCTTTCTAAAGG - Intronic
1188031904 X:25273704-25273726 CACCACACCCAGCCTTCTACAGG - Intergenic
1188345791 X:29064006-29064028 CCACACACTCATCTTTCTATAGG - Intronic
1192001701 X:67158547-67158569 CCCCACACTCCACTTTCTCTGGG - Intergenic
1195952637 X:110292074-110292096 CCCATCACTCAGCTTCCCACTGG - Intronic
1197167291 X:123392060-123392082 CCCCAACCTGAGCATTCTACTGG - Intronic