ID: 999684426

View in Genome Browser
Species Human (GRCh38)
Location 5:154089484-154089506
Sequence CAGGGCTAGCAGAGGGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 222}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999684426 Original CRISPR CAGGGCTAGCAGAGGGATCC AGG (reversed) Intronic
900718540 1:4160404-4160426 CAGGGCTGGCACAGGGACCATGG + Intergenic
900897830 1:5496152-5496174 CAGGGCTCGGACAGGGAGCCTGG + Intergenic
903228762 1:21909319-21909341 CAGGGCAGGCAGATGGAGCCTGG + Intronic
903808856 1:26023311-26023333 CAGGGCTAGCAGGGCTACCCCGG - Exonic
904276011 1:29384719-29384741 CAGGGCTGGCAGAGTGACCAAGG + Intergenic
905873381 1:41417336-41417358 CAGGGCTTGCTGAGTGACCCTGG + Intergenic
906322577 1:44826398-44826420 CAGGGCTCACAGAGGGCTCCTGG + Intronic
906627174 1:47334395-47334417 GTGGGCTGGGAGAGGGATCCCGG + Intronic
907389975 1:54151794-54151816 CAGTGCAGGCAGAGGGTTCCAGG + Intronic
907909641 1:58815041-58815063 CAGGGCTAGGAGTGAGATCTTGG - Intergenic
918177819 1:182060780-182060802 CAGGGACAGCAAAGGGATGCTGG + Intronic
920184424 1:204151534-204151556 CAGGGCTGCCAGGGGGATGCGGG - Intronic
921235560 1:213124125-213124147 CAGGGCTATTAGAGGGCCCCAGG - Intronic
921374604 1:214460850-214460872 CATGGCTTTCAGAAGGATCCAGG - Intronic
922414011 1:225403847-225403869 CTGGGGGAGCAGGGGGATCCAGG - Intronic
922534566 1:226370404-226370426 CAGGGCTACCAGGGGCCTCCTGG - Intronic
922806194 1:228391318-228391340 CAGGGAAAGCACAGGGATCCGGG + Intergenic
923786713 1:237074950-237074972 CAGGTCTCGGAGAGGGATCTGGG + Intronic
924737211 1:246768990-246769012 CAGGGCCAGCAAAGGCATCACGG - Intergenic
924763140 1:247007710-247007732 CCGGGCCGGCAGCGGGATCCCGG - Intronic
1062988787 10:1795694-1795716 GTGGCCTTGCAGAGGGATCCTGG + Intergenic
1063053241 10:2475937-2475959 CAGGGCCAGCAGGGAGAGCCAGG - Intergenic
1063533317 10:6857387-6857409 CAGGTCTACCAGAGGTTTCCTGG - Intergenic
1064244452 10:13657667-13657689 CAGGGCTGCCCCAGGGATCCGGG + Intronic
1067098210 10:43316111-43316133 CAGTTCTACCAAAGGGATCCGGG - Intergenic
1067295430 10:44972881-44972903 CAGAGCTAGCCCAGGCATCCAGG + Intronic
1069059105 10:63875043-63875065 CAGTGGTTGCAGTGGGATCCTGG - Intergenic
1070363740 10:75716008-75716030 CAGTGCTAGAAGAGGCATGCTGG + Intronic
1070662419 10:78316787-78316809 CAGGGCAGGCAGAGGGAACCAGG + Intergenic
1071464999 10:85931694-85931716 AAGGGATACCAAAGGGATCCAGG - Intronic
1073122890 10:101132897-101132919 CAGGGCCAGCAGAGGAAGGCGGG - Intronic
1073419647 10:103414190-103414212 CAGGGCTACCACAGGCATGCTGG - Intronic
1073778226 10:106809441-106809463 CAGGGCTAGCAGGGGGATCCTGG - Intronic
1075734354 10:124654834-124654856 CAGGGCGAGCAGAGGCACGCCGG - Intronic
1077476319 11:2792113-2792135 CAGGGGTGGCGGAGGGACCCGGG - Intronic
1077551613 11:3203037-3203059 CAGGGCAGGCAGCGGGCTCCAGG - Intergenic
1078012084 11:7580235-7580257 GAGGGCCAGCAGAGGTTTCCTGG - Intronic
1080851243 11:36072184-36072206 GAGGTCTAGAAGAGAGATCCTGG + Intronic
1081525399 11:43924554-43924576 CGGGGCTAGCACTGGGTTCCCGG - Intergenic
1083270421 11:61569500-61569522 CTGGGGCAGCAGAGGGAGCCAGG + Intronic
1083280927 11:61626979-61627001 TAGGGCTAGAGGAGGCATCCTGG - Intergenic
1083325702 11:61871975-61871997 CAGTGCCAGCAGAGGCCTCCTGG - Intergenic
1083861806 11:65423970-65423992 CATGGCGAGCAGATGGAACCGGG + Intergenic
1083934283 11:65862276-65862298 CAGGGTGAGCACAGGGATCAGGG + Exonic
1084170403 11:67398228-67398250 CAGGGCTGGCAGCCGGATCCTGG - Exonic
1085282863 11:75342243-75342265 CAGGGCTCGGAGAGGGAAGCAGG - Intronic
1085807964 11:79653873-79653895 TAGGGCTAGAAGTGGGTTCCGGG - Intergenic
1088626930 11:111736240-111736262 CTCGGCTAGCAGAGGCAGCCCGG + Intronic
1089342711 11:117770225-117770247 CAGGCCTTGCAGAGGAGTCCAGG - Intronic
1091568624 12:1665129-1665151 CAGGGCTGGCACAGGGAAGCTGG - Intergenic
1091628125 12:2138347-2138369 CTGTGCTTGCAGATGGATCCTGG + Intronic
1095833549 12:46613063-46613085 CAGGGTTAGTAGAGGGAACATGG - Intergenic
1100778372 12:97997122-97997144 CAAAGCTAACACAGGGATCCAGG - Intergenic
1103173416 12:118841906-118841928 CCAGGCCAGCAGAGGGATGCTGG + Intergenic
1104717774 12:131027733-131027755 CATGGCTGGCAGGGGGATGCAGG - Intronic
1104871526 12:132001707-132001729 CAGGGCCACCAGAGGGCTCCTGG - Intronic
1104878289 12:132051939-132051961 CAGGGCCACCAGAGGGCTCCTGG - Intronic
1105020132 12:132810640-132810662 CAGGGCCACCAGAGGGCTCCTGG + Intronic
1105043055 12:132977062-132977084 CAGGGCCACCAGAGGGCTCCTGG + Intergenic
1107022517 13:35766143-35766165 CAGATCCAGCAGAGGGATCGGGG + Intergenic
1110080329 13:71302169-71302191 GAATGCTAGCAGAGGAATCCAGG + Intergenic
1111769230 13:92575468-92575490 CAGAGCCTGCAGAGGGAACCTGG + Intronic
1112466176 13:99646872-99646894 CAGGGCTAGCAGGCAGATCTAGG - Intronic
1113604560 13:111596058-111596080 CAGGGCTTGCACAGGGATGTAGG + Intronic
1113707034 13:112441711-112441733 CAGGAATAGCAGAGGCCTCCTGG - Intergenic
1113931019 13:113968943-113968965 ATGGGCCAGCAGAGGGAGCCAGG - Intergenic
1115993763 14:39175030-39175052 CTGCGCTAGCAGCGGGATCCAGG + Intergenic
1117283967 14:54268091-54268113 CAGGGCTAGCAAAGGAAACTGGG + Intergenic
1118879008 14:69810387-69810409 CAGGTCTATCAGAGGGCTCAGGG + Intergenic
1120953761 14:90063808-90063830 CAGGGCTAGTCCAGGAATCCAGG + Intronic
1122123908 14:99569008-99569030 ATGGGCTAGCTGAGGGTTCCTGG + Intronic
1123203546 14:106691484-106691506 CAGGACTAGCAGGGGCATGCAGG - Intergenic
1125584510 15:40810538-40810560 CAGGGAAAGGAGAGGGATCCAGG - Intronic
1128226050 15:66001956-66001978 CAGGGCTGGCAGGGGGATGGGGG + Intronic
1129254626 15:74327104-74327126 CAGGGCATGGAGAGGGATCTCGG - Intronic
1132515133 16:362708-362730 CAAGGCCATCAGAGGGACCCGGG + Intergenic
1132752432 16:1464972-1464994 CAGGGCAAGGACAGGGATCTTGG - Intronic
1132802230 16:1760065-1760087 CAGGGCTGGGAGAGTGAGCCGGG + Intronic
1136186377 16:28591098-28591120 CAGGGCTGGCAAAGGGATGGTGG - Intronic
1136708264 16:32209221-32209243 CAGGCCTGGCAGAGGGTCCCTGG - Intergenic
1137440919 16:48497989-48498011 CTGGGCTAGAAGAGGGGTCTGGG - Intergenic
1138014401 16:53415653-53415675 AGGGGCTAGCAGAGGCAGCCAGG - Intergenic
1138351872 16:56350331-56350353 CAGGGCTAGGACAGGGTTCTTGG + Intronic
1138669654 16:58603134-58603156 GAGGGCTAGCATAGTAATCCAGG - Intronic
1140520464 16:75576576-75576598 CAGAGCTTGCATAGGGATCCAGG + Intronic
1140875977 16:79152898-79152920 CAGGGATAGAAGTGGGCTCCGGG + Intronic
1141994031 16:87625750-87625772 CAGGGCTAGCAAAGGAGACCCGG + Intronic
1143407024 17:6684394-6684416 CATGGCTAGCAGAAGGAGCAGGG + Intergenic
1146823277 17:36001509-36001531 CAGGGCTGGCCGAGGACTCCTGG + Exonic
1146825362 17:36017914-36017936 CAGGGCTGGCCGAGGACTCCTGG + Exonic
1147440590 17:40444693-40444715 CAGGGCAGGCAGAGGTGTCCAGG - Intronic
1147595298 17:41712777-41712799 AAGGGCTTGAAGTGGGATCCAGG - Intronic
1147650380 17:42058569-42058591 CAGAGCTGGAAGAGGCATCCAGG + Intronic
1148127193 17:45242942-45242964 CAGGGGAAGCACAGGGAGCCTGG - Intronic
1148148958 17:45384870-45384892 CACGGACAGCAGAGGCATCCCGG + Intergenic
1149389123 17:56171864-56171886 CAGGGCTAGCAAAAGAATCAAGG + Intronic
1149598278 17:57876697-57876719 CAGGTCTAGCAGAGCCATCCTGG + Intronic
1151095895 17:71497818-71497840 CAGGGCTCACAGATGGACCCTGG + Intergenic
1151284089 17:73097177-73097199 GGGGGCAAGCAGAGGGATCATGG + Intergenic
1151328776 17:73394607-73394629 GAGGGCTGGCAGAGGGACCAGGG + Intronic
1151380748 17:73724214-73724236 CAGTGCTAGGAGAGGGAGGCTGG + Intergenic
1152230876 17:79113470-79113492 CAGGTCTGGCAGAGGGTTCAGGG - Intronic
1160239775 18:77114853-77114875 CAGGGCGAGCAGTGGGCTGCAGG + Intronic
1160680630 19:410378-410400 CAGTGGTAGAAGAGGGGTCCAGG + Intergenic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1161167209 19:2794677-2794699 CAGGCCTGGGAGAGGGGTCCGGG + Intronic
1162324569 19:9991512-9991534 CAGAGCTAACAGAGGGGTCTTGG + Intronic
1162741839 19:12778061-12778083 GAGGGGTTGCAGAGGGACCCTGG - Intronic
1164051434 19:21587836-21587858 CAGGCCTAGTAGAGGCTTCCAGG + Intergenic
1164670103 19:30067574-30067596 CAGGCTGGGCAGAGGGATCCTGG + Intergenic
1165841749 19:38792443-38792465 CAGGGCTAGGACCGGGGTCCGGG - Intergenic
1166077558 19:40422648-40422670 CAGGGCTGGCAGGGGGAGCCTGG - Exonic
1166142962 19:40815195-40815217 CAGGGATGGCAAAGAGATCCTGG - Intronic
1166184597 19:41131626-41131648 CAGGGATGGCAGAGAAATCCTGG + Intergenic
1166228071 19:41409500-41409522 CTGGGCTCGCAGAGGGAGCTGGG + Intronic
1166260936 19:41640447-41640469 CAGGGCTCTGAGAGGGATCGAGG - Intronic
1166305777 19:41936214-41936236 CAGGGAAGGCCGAGGGATCCAGG - Intergenic
1166483335 19:43191881-43191903 CAGGGCCACTAGAGGGCTCCTGG - Intronic
1167153415 19:47723131-47723153 CAGGGTGGGCAGGGGGATCCAGG - Intronic
1167665712 19:50821926-50821948 CAAGGCTAGGAGAGGGAGCTGGG + Intronic
1167705693 19:51079684-51079706 CAGGGCAACCTGAAGGATCCTGG + Exonic
1167722470 19:51187803-51187825 CAGGACTAGCTGAGCAATCCTGG - Intergenic
925153921 2:1635969-1635991 CAGGGGTAGCAGAAGCCTCCTGG + Intronic
926686023 2:15698279-15698301 CAGAGCTAGCACAGTGATGCTGG - Intronic
928316815 2:30252813-30252835 CAGGGCTGGCAGAGGGAGGAAGG + Intronic
929791046 2:45023439-45023461 CAGGGCTGGTGGAGGGATGCTGG - Intergenic
931597695 2:63967766-63967788 AAGGGGTAGCAGAGGGATGAGGG + Intronic
932467680 2:71934050-71934072 CAGGGCTTGCAGAAGGCACCAGG + Intergenic
932510215 2:72279293-72279315 AAGGCCTAGCAGAGGAATACAGG - Intronic
933777359 2:85779108-85779130 CAGAGCCAGAAGAGGCATCCAGG - Intronic
934118946 2:88822155-88822177 CAGTGCCTGCAGAGGGGTCCCGG + Intergenic
934757255 2:96832782-96832804 CAGGGCCGGCTGAAGGATCCAGG - Exonic
937445538 2:121955021-121955043 CAGGGCTACCAGAAGTATCAAGG - Intergenic
938134419 2:128742658-128742680 CAGGGATAGGACAGGGAGCCAGG + Intergenic
940435166 2:153644504-153644526 CAGTACTAGTAGAGGGATCTCGG + Intergenic
940992677 2:160113959-160113981 CAAGGCGAGCAGAGTGAGCCTGG - Intronic
946032471 2:216716129-216716151 CAGGGCAACCAGAGTGCTCCGGG - Intergenic
946208446 2:218128169-218128191 CAGGGCTAGCTGAGCAATTCTGG - Intronic
946332474 2:219018185-219018207 CAGACTTAGGAGAGGGATCCAGG - Intronic
946806862 2:223479623-223479645 CAGGGCTGGCAGTGCTATCCAGG + Intergenic
948974974 2:241458400-241458422 CAGGGCTACCCGTGGGATGCTGG + Intronic
1168947794 20:1776332-1776354 CAGAGCTAGCACAGGGACCAAGG - Intergenic
1169315004 20:4583112-4583134 CGGAGCTAGCACAGTGATCCAGG + Intergenic
1170762710 20:19264875-19264897 CTGAGCTTCCAGAGGGATCCTGG + Intronic
1172644998 20:36463431-36463453 CAGAGCTGGGACAGGGATCCAGG + Intronic
1174341072 20:49895850-49895872 CAGGGCTAGAAGAGGAATCGTGG - Intergenic
1175624793 20:60481379-60481401 CAGGGAATGCAGAGGGACCCTGG - Intergenic
1175974216 20:62702285-62702307 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175974240 20:62702355-62702377 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1176032071 20:63017488-63017510 CAGGACTTGCAGAGGGGGCCTGG + Intergenic
1179547209 21:42120837-42120859 CAGGGCTGGGAGGGGGATCTGGG - Intronic
1181809180 22:25393061-25393083 CATGGCTAGCCGAGGGCTCATGG - Intronic
1183352613 22:37342567-37342589 CAGGGGCAGCAGTGGGACCCAGG - Intergenic
1183778768 22:39985193-39985215 CAGGGGTGTCAGAGGCATCCCGG + Intergenic
1184982752 22:48105825-48105847 CAGGGAGAGCAGAGGGATGTGGG - Intergenic
949605831 3:5652493-5652515 CAGGGATGGCAAAGGGACCCTGG + Intergenic
949839992 3:8309863-8309885 CAGGCCTAGCAGTGGGATTGAGG - Intergenic
950068827 3:10135993-10136015 CAGAGCTAGCAGTGGCAACCCGG - Intergenic
950707640 3:14792890-14792912 CAGGGAGAGCACAGGCATCCAGG - Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951145012 3:19216271-19216293 CAGTGCTAGCAGAGGCAGGCTGG + Intronic
954136852 3:48585837-48585859 CAGGGCCAGAAGGGGGAACCTGG - Exonic
956001614 3:64735607-64735629 CAGTGATGCCAGAGGGATCCAGG + Intergenic
958159079 3:89793242-89793264 CAAGGCAAACAGAGAGATCCAGG - Intergenic
962381474 3:134901637-134901659 CAGGGCAAGAAGAGTCATCCAGG + Intronic
963913198 3:150832621-150832643 CTGTCGTAGCAGAGGGATCCGGG + Intergenic
964920811 3:161893101-161893123 CAGGACTAGAAGACAGATCCAGG + Intergenic
968698078 4:2042332-2042354 CATGGCCAGCAGAGGGAGCGGGG - Exonic
969244471 4:5923562-5923584 CAGGGCTGGGCGAGGGATCGGGG + Intronic
969322286 4:6419748-6419770 CAGAGCTTCCAGAGGGAGCCAGG - Intronic
969408046 4:7007908-7007930 CCAGGCTCTCAGAGGGATCCAGG + Intronic
969489334 4:7490318-7490340 CAGGCCTGGCAGAGGGAGGCAGG - Intronic
970176967 4:13349266-13349288 GAGGGCTAGCATAGAGATTCAGG + Intergenic
971196536 4:24475606-24475628 CAGGGCCTGCAGAGGCATCCAGG + Intergenic
972780003 4:42279269-42279291 CATGGCTGGCAGAGGAATCTTGG - Intergenic
973603246 4:52562140-52562162 CAGGGCCAGCAGTGCCATCCAGG + Intergenic
977747647 4:100569468-100569490 CAGGGCAAGCAGAGGGAGATGGG - Intronic
979553050 4:122012967-122012989 CAGGGCTGGCTGAGCCATCCTGG + Intergenic
985658396 5:1143736-1143758 CAGGGCTTGCAGAGGGGACTGGG - Intergenic
985732388 5:1556537-1556559 CAGGGCCAGCAGTGGGGTGCGGG + Intergenic
988260649 5:28882586-28882608 CAGGGCAATCAGAGGGCTCTGGG - Intergenic
989403310 5:41032779-41032801 TAGGGCTAGCTAAGGAATCCAGG + Exonic
991120633 5:63008979-63009001 CAGAGCTAGCAGTGGCAACCTGG + Intergenic
997007101 5:129830952-129830974 CAGAGCTAGCAAAGGCAGCCAGG - Intergenic
999499675 5:152134309-152134331 AAAGGCTAACAGAGGGATTCTGG + Intergenic
999662294 5:153878201-153878223 CAGGGCTTGCTGAGGGAGCTGGG - Intergenic
999684426 5:154089484-154089506 CAGGGCTAGCAGAGGGATCCAGG - Intronic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1002326584 5:178413747-178413769 CAAGGTTAGCAGAGGGTTCCAGG + Intronic
1002660795 5:180790154-180790176 CTGGGCCAGCAGAGGGCACCGGG + Intergenic
1003119011 6:3304883-3304905 CAGGGAGAGGAGAGGGATGCAGG + Intronic
1003883819 6:10502706-10502728 CAGGGCAGGCAGAGGAGTCCAGG - Intronic
1006193187 6:32221956-32221978 CAGAGCTAGCATTTGGATCCAGG + Intronic
1008568290 6:52790694-52790716 CAGGGCTAGCAAACGCACCCAGG + Intergenic
1008572740 6:52830682-52830704 CAGGGCTAGCAAATGCATCTAGG + Intergenic
1008579689 6:52895648-52895670 CAGGGCTAGCAAATGCACCCAGG + Intronic
1010732770 6:79408790-79408812 CAGGGCTATCACAAGGAGCCAGG - Intergenic
1011802258 6:91030709-91030731 CAGGGGTAGCTGATGGATTCGGG + Intergenic
1013413209 6:109900515-109900537 CAGGAGTGGCAGAGGGATTCAGG - Intergenic
1019494755 7:1332514-1332536 CAGCCCTAGGAGAGGGAGCCAGG - Intergenic
1019763212 7:2829766-2829788 GAGGGCTACCACAGGGATGCTGG - Intronic
1023882282 7:44327106-44327128 CTGAGGAAGCAGAGGGATCCTGG + Intronic
1024222141 7:47297337-47297359 CCAGCCAAGCAGAGGGATCCCGG - Intronic
1025140217 7:56456813-56456835 CAGGGTTAGGAGAGTCATCCCGG + Intergenic
1026390423 7:69896054-69896076 CAACACTAGCAGAGGGAGCCAGG - Intronic
1026637638 7:72098169-72098191 CAGGGCTGATGGAGGGATCCTGG + Intronic
1030375869 7:108752957-108752979 CAGCTCTAGCAGAAGGATCTAGG + Intergenic
1031854986 7:126911665-126911687 CAGGGGAAGCAGAGAAATCCAGG + Intronic
1032675653 7:134127692-134127714 CAGGGCTGGACGAGGGAGCCAGG - Intronic
1033217813 7:139506252-139506274 GAGGTCTAGCAGTGGGATCAGGG + Intergenic
1035265581 7:157688946-157688968 CAGAGCCAGGAGAGGGGTCCCGG + Intronic
1036182494 8:6597526-6597548 CTGGGCTGGGAGAGGGCTCCGGG - Intronic
1036708464 8:11061932-11061954 CAGGGCCAGCCGAGGGACACAGG - Intronic
1038201073 8:25413217-25413239 CAGGCCTAGCAGAGGAAAGCAGG - Exonic
1040006834 8:42628132-42628154 CAGGGGGAGCAGAGGGACCAGGG - Intergenic
1046062107 8:109151895-109151917 CAGGTCTAGCTGAGGTATGCAGG + Intergenic
1046988236 8:120415758-120415780 CAGGGCAAGCAGAGGATGCCTGG + Intronic
1047779277 8:128098356-128098378 CAGGCCTGGCAGAGGGGTGCAGG + Intergenic
1048165766 8:132059912-132059934 CAGGGCTGGCAGAGGAACCTTGG - Intronic
1048505185 8:135014593-135014615 CTGGTCTTGCAGGGGGATCCTGG - Intergenic
1049572618 8:143376351-143376373 CAGGGGCAGCAGTGGGATCCGGG - Intronic
1049654392 8:143791389-143791411 CAGGGCTGGGAGATGGTTCCAGG + Exonic
1050062449 9:1724133-1724155 CAGGGCAAACAGAGGTATCAGGG - Intergenic
1050609798 9:7339870-7339892 CAGGCCTAGGAGAGGCAACCTGG - Intergenic
1053105513 9:35404819-35404841 GAGGGCTAGTTGAAGGATCCAGG + Exonic
1056773791 9:89497649-89497671 GAGGGATAGCAGAGAGGTCCAGG + Intronic
1056804528 9:89718374-89718396 CAGAGCCATCAGAGTGATCCTGG + Intergenic
1058425967 9:104875499-104875521 CAGGACTGGCAGAGAGATCCGGG - Intronic
1060496881 9:124125732-124125754 AGGGGCTGGCAGAGGGATTCGGG - Intergenic
1060926169 9:127456917-127456939 CAGGGCTGGCAGAGGGGCCAGGG - Intronic
1061182077 9:129030274-129030296 CAGGGCTGGGAGAGGGAACAGGG - Intergenic
1061329024 9:129880733-129880755 CAGGGGTAGCATCGGGCTCCAGG - Exonic
1061499832 9:130995469-130995491 TGGGCCTAGCAGTGGGATCCTGG + Intergenic
1061626090 9:131841533-131841555 CTGGGCTGGCGGAGGGCTCCTGG + Intergenic
1061750512 9:132773801-132773823 CAGGGCAAGAAGAGGCATCAGGG + Intronic
1061926979 9:133810752-133810774 CAGGGACAGCAGCGGGCTCCAGG + Intronic
1062246355 9:135569022-135569044 CAGGGCCTGCAGAGAGACCCTGG + Intergenic
1062394399 9:136346927-136346949 CAGGGCTAACGGTGGGGTCCGGG + Intronic
1062551498 9:137089540-137089562 CAGGGCTGGGAGAGGGAGCAGGG + Intronic
1190338807 X:49280126-49280148 GAGGGTTAGCATAGGGACCCAGG + Intronic
1190932311 X:54959566-54959588 CAGGGCCAGAAGTGGAATCCAGG - Intronic
1195568862 X:106377129-106377151 AAGAGGTAGCAGAGGGAGCCTGG - Intergenic
1200141651 X:153905598-153905620 CCGGGCTAGCAGCGGGTCCCGGG - Exonic
1200770733 Y:7122993-7123015 CAGGGTTAGCAGTGGGATTTAGG - Intergenic