ID: 999689946

View in Genome Browser
Species Human (GRCh38)
Location 5:154138205-154138227
Sequence TCCCAGGTAGCTAGGTCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84911
Summary {0: 1, 1: 20, 2: 883, 3: 10388, 4: 73619}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999689946_999689954 7 Left 999689946 5:154138205-154138227 CCTATAGACCTAGCTACCTGGGA 0: 1
1: 20
2: 883
3: 10388
4: 73619
Right 999689954 5:154138235-154138257 GCGGAGGATTGCTTAAGCCCAGG 0: 1
1: 37
2: 1397
3: 17751
4: 56070
999689946_999689951 -9 Left 999689946 5:154138205-154138227 CCTATAGACCTAGCTACCTGGGA 0: 1
1: 20
2: 883
3: 10388
4: 73619
Right 999689951 5:154138219-154138241 TACCTGGGAGGCCGAGGCGGAGG 0: 1
1: 4
2: 202
3: 3004
4: 11887

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999689946 Original CRISPR TCCCAGGTAGCTAGGTCTAT AGG (reversed) Intronic
Too many off-targets to display for this crispr