ID: 999691260

View in Genome Browser
Species Human (GRCh38)
Location 5:154147833-154147855
Sequence TATGATGCACAGAGGGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999691260 Original CRISPR TATGATGCACAGAGGGTTCC AGG (reversed) Intronic
904686490 1:32264533-32264555 AATAATACACTGAGGGTTCCTGG - Intronic
904838376 1:33354377-33354399 TATGAAGCACAGTGGGGCCCTGG - Intronic
904936803 1:34136601-34136623 AATGATGCAGAGAGGAGTCCAGG - Intronic
906713972 1:47953215-47953237 GATGATGCACAGAGGGGTGTGGG + Intronic
907353758 1:53855187-53855209 AATGATGCAGAGAGGGCTTCTGG - Intronic
907371893 1:54009170-54009192 CCTGGTGCACAGAGCGTTCCAGG - Intronic
908353900 1:63313160-63313182 TATGAGGCACAGAGAGTTTAAGG + Intergenic
909170567 1:72287948-72287970 TATAATTTACAGTGGGTTCCAGG + Intergenic
910100046 1:83565957-83565979 TTTGAGGCACTCAGGGTTCCTGG - Intergenic
910965006 1:92799560-92799582 TATGATCCACAAAGTTTTCCTGG + Intergenic
917655092 1:177118350-177118372 TAACATGCACAGAGTGTTCATGG + Intronic
918868056 1:189929576-189929598 TCTGCTGCAGAGAGGGGTCCCGG + Intergenic
921777717 1:219121815-219121837 TAAGATTCACAGTTGGTTCCTGG - Intergenic
924604263 1:245518918-245518940 AATCATGCACAAAGGGATCCGGG - Intronic
1062978938 10:1705745-1705767 TGTGCTGCTCTGAGGGTTCCAGG + Intronic
1065037049 10:21650021-21650043 TATGTTGCCCAGAGTGTTCTCGG - Intronic
1065741795 10:28803530-28803552 TCTGATGCAGAGAGGGGTCCTGG - Intergenic
1065774455 10:29106500-29106522 AGTGATGCACGGAGAGTTCCCGG + Intergenic
1067290638 10:44937115-44937137 TCTGAGGCACATAGGCTTCCTGG + Intergenic
1067834973 10:49632820-49632842 CATGAGGCCCACAGGGTTCCAGG + Intronic
1068306269 10:55212363-55212385 GATGCTGCAGAGAGGGGTCCTGG - Intronic
1069177811 10:65315628-65315650 TATAATGAGCAGAGGGTCCCAGG - Intergenic
1070920701 10:80183808-80183830 GCTGATGCACTGAGGGTTTCTGG - Intronic
1071798747 10:89034206-89034228 TATGAGGCACAGAAAGTACCTGG - Intergenic
1072010132 10:91295754-91295776 TATGATGCACAGAGAGAAACTGG + Intergenic
1074480416 10:113815280-113815302 CATGATGATCAGAGGGTTCAGGG - Intergenic
1077667797 11:4129949-4129971 TAAGATGCACACAGGTTTTCTGG - Intronic
1081301881 11:41462673-41462695 TTTGATACACAGAGGGGTCCTGG + Intergenic
1085616087 11:78000034-78000056 TATTATTCTCAGAGGGTACCAGG - Intergenic
1089812960 11:121146778-121146800 TAGCATGCACAGAGTGTGCCTGG - Intronic
1095871480 12:47033204-47033226 CATAGTGCACAGAGTGTTCCTGG + Intergenic
1096354779 12:50931155-50931177 TCTGTTGCAGAGAGGGGTCCTGG + Exonic
1097084353 12:56456145-56456167 TGAGATGCACTGAGGGTTACAGG - Intronic
1102228810 12:111248276-111248298 ACTGAGGCACAGAGTGTTCCAGG + Intronic
1102980680 12:117238472-117238494 TCTGCTGCACAGAGGGGTCCTGG - Intronic
1103040192 12:117688514-117688536 TATGATGCAGAGAGTGGTTCTGG - Intronic
1103344187 12:120238393-120238415 CATGCAGCAGAGAGGGTTCCAGG + Intronic
1103676583 12:122660742-122660764 TAAGATACACAGAGGTCTCCAGG - Intergenic
1104575784 12:129964858-129964880 TCTGCTGCAGAGAGGGGTCCTGG + Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1106905927 13:34408800-34408822 TGTGGGGCACAGATGGTTCCTGG - Intergenic
1107886038 13:44874826-44874848 TCTGATGCACAGTGGGTGCCTGG + Intergenic
1108792085 13:53982551-53982573 TAGGAAGCACATAGGGTTTCTGG - Intergenic
1110483898 13:76015892-76015914 TATGTGGCACACAGGGTCCCCGG - Intergenic
1110685641 13:78370382-78370404 TACAATGCTCAGAGTGTTCCTGG + Intergenic
1111012700 13:82331588-82331610 TCTGCTGCAAAGAGGGGTCCCGG - Intergenic
1114538457 14:23437587-23437609 TAAGATGCACAAAGGGTGCTTGG + Intergenic
1115722709 14:36180832-36180854 TATTAAGCAAAGCGGGTTCCTGG - Intergenic
1118670751 14:68124004-68124026 TCTGATGCACAGAGAGTCCAGGG - Intronic
1119549039 14:75494727-75494749 CATGATGCCCAAAGGGTCCCTGG + Intergenic
1121664788 14:95664286-95664308 TCTGATGCACAGTGGCTGCCTGG - Intergenic
1121711820 14:96044095-96044117 GCTGATCCACAGAGGGTCCCTGG - Intronic
1125379239 15:39069888-39069910 TAAGAAGCACCAAGGGTTCCCGG + Intergenic
1126310269 15:47307959-47307981 TATGATGCACAGAGAAATTCTGG + Intronic
1130308371 15:82730836-82730858 TCTGCTGCAGAGAGGGGTCCTGG + Intergenic
1131553124 15:93374877-93374899 TATGATACACAGGGGGTTTGCGG - Intergenic
1132054557 15:98639581-98639603 TATGTTGCTCAGATTGTTCCAGG - Intergenic
1136283853 16:29230138-29230160 TATGTTCCACAGAGGGTGCTTGG + Intergenic
1137668385 16:50265359-50265381 TAGGACTCACACAGGGTTCCAGG - Intronic
1139743598 16:69056614-69056636 TATGATGAAAAAAGGGTTCTTGG - Intronic
1140835256 16:78788255-78788277 TATGATATATATAGGGTTCCTGG + Intronic
1140926507 16:79589569-79589591 TCTTATTTACAGAGGGTTCCTGG + Intronic
1141179216 16:81741000-81741022 TATGGGGCACAGAGGGTGCATGG - Intronic
1142088888 16:88199648-88199670 TATGTTCCACAGAGGGTGCTTGG + Intergenic
1150626756 17:66846806-66846828 TATGTTGCACACAGAGTTACCGG - Intronic
1151426614 17:74034861-74034883 TAAGAGGCACAGCGGCTTCCTGG + Intergenic
1160006665 18:75073435-75073457 TATGAGCCACAGAGGGTCCTGGG - Intergenic
1161831057 19:6604840-6604862 TCTGCTGCAGAGAGGGGTCCCGG + Intergenic
1164535655 19:29084874-29084896 GATGCTGCACTGAGGGTCCCCGG + Intergenic
1164683824 19:30153515-30153537 CAGGATGCATAGAGGCTTCCAGG - Intergenic
1165692155 19:37871996-37872018 TCTGCTGCAGAGAGGGGTCCTGG + Intergenic
926247735 2:11133230-11133252 TAGGAGGGACAGAGTGTTCCAGG + Exonic
932141973 2:69287055-69287077 CCAGAGGCACAGAGGGTTCCTGG + Intergenic
935015839 2:99181300-99181322 TAGGATCTGCAGAGGGTTCCCGG - Intronic
938669345 2:133572174-133572196 TATCATCCTCAGAGGGATCCAGG - Intergenic
943963626 2:194301522-194301544 AATGATGCACAGATGACTCCAGG + Intergenic
945367762 2:208977683-208977705 TCTGTTACAAAGAGGGTTCCCGG - Intergenic
945791458 2:214310611-214310633 TGGGATGCACTGAGGTTTCCAGG + Intronic
947246800 2:228057619-228057641 TAAGATGGAGAGAGGTTTCCAGG + Intronic
948320112 2:237062196-237062218 TATGATGCCCAGTGGGTGACAGG - Intergenic
1169957326 20:11118963-11118985 TGTGATTCACAGAAGATTCCAGG - Intergenic
1171065221 20:22008607-22008629 TATGAGGCACAAAGGTCTCCTGG + Intergenic
1172409876 20:34713020-34713042 CAAGTTGCTCAGAGGGTTCCAGG - Exonic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1176186838 20:63784868-63784890 GATGATGCACAGAGGGGTTGGGG + Intronic
1177868955 21:26547095-26547117 AATCAAGCACAGAGGGGTCCAGG + Intronic
1179991316 21:44949501-44949523 GCTGCTGCACAGAGGGTTCTGGG - Intronic
1182475881 22:30575983-30576005 CATGATGCACTGGCGGTTCCAGG + Intergenic
1183254661 22:36754573-36754595 AATGATGCCTAGAGGGTGCCAGG + Intergenic
1183702900 22:39459803-39459825 GAGGATGCACACAGGGTGCCTGG + Intronic
949256344 3:2051120-2051142 AGTGATGTAGAGAGGGTTCCTGG + Intergenic
951512448 3:23518639-23518661 TATTCTCCACAGTGGGTTCCAGG + Intronic
951670949 3:25181274-25181296 TACGATGCACAGTGGGTACCTGG - Intronic
956177932 3:66491070-66491092 AATCAAGCACAGAGGGTTCCAGG + Intronic
961621262 3:128226853-128226875 TGTGGTGCACAGAGGGTAGCTGG + Intronic
966545360 3:181140439-181140461 TGTGCTGGACAGCGGGTTCCAGG - Intergenic
968763545 4:2456102-2456124 TATGAGGCACAGAGGTTCCTTGG - Intronic
969094307 4:4720269-4720291 TATGATGTATCGAGTGTTCCTGG - Intergenic
976591011 4:86849977-86849999 TAGAATGCACAGAGGGGCCCTGG - Intergenic
977580687 4:98721824-98721846 TATGTTTCAAAGAGCGTTCCAGG + Intergenic
983760539 4:171400872-171400894 TCTGAAGCATTGAGGGTTCCAGG - Intergenic
988599088 5:32622832-32622854 TGGAAAGCACAGAGGGTTCCTGG - Intergenic
994524172 5:100882673-100882695 TAGGCTGCACACAGGGATCCTGG - Intronic
995062043 5:107821709-107821731 TCTCATGCACAGAGGGTGCTTGG + Intergenic
997602905 5:135152510-135152532 TAGGATGGACAGAGGGATCATGG - Intronic
999691260 5:154147833-154147855 TATGATGCACAGAGGGTTCCAGG - Intronic
999776555 5:154816749-154816771 TAGGATGAACAGAGGGATCTGGG - Exonic
1001242030 5:170078303-170078325 AATGATGGCCAGAGGGCTCCAGG - Intronic
1001752093 5:174139292-174139314 AATGTTGCACAGAAGGTGCCTGG + Intronic
1004777503 6:18864284-18864306 TGTGAAGCACAGAGGGATCTTGG + Intergenic
1006385341 6:33727630-33727652 TGTGGTGCTCAGAGGGTCCCTGG - Intronic
1007014149 6:38446372-38446394 TCTGATGCAGAGAGGGGTCCCGG + Intronic
1011053994 6:83186103-83186125 TACGATGTACAGAGTGTTGCCGG - Intronic
1013036842 6:106393270-106393292 AATGATGCACAGGGGGTCCAGGG + Intergenic
1013339421 6:109199024-109199046 TTGGATGCACAGAGTGTCCCGGG + Intergenic
1013669001 6:112377662-112377684 TAAGGTGCACTGATGGTTCCAGG - Intergenic
1017659389 6:156659003-156659025 TAGGATGCTCAGCGGTTTCCTGG - Intergenic
1018070179 6:160157654-160157676 AAGGATGCACAGGGGGTTCAGGG - Intronic
1018723092 6:166588735-166588757 GATGATGGACACAGGGTTCCCGG + Intronic
1019006170 6:168798592-168798614 TAGGATGCACAGAGAGACCCTGG + Intergenic
1024690552 7:51796908-51796930 TCTGCTGCAGAGAGGGGTCCTGG - Intergenic
1026491019 7:70863559-70863581 TATGATGCACAGAGAGCTGGTGG + Intergenic
1029885765 7:103869523-103869545 TATGATGCATATAGTGTTCTGGG + Intronic
1030258525 7:107538425-107538447 TCTGCTGCAGAGAGGGGTCCTGG - Intronic
1033534357 7:142298516-142298538 AATGATGCACAGCTGGCTCCAGG + Intergenic
1035230454 7:157462749-157462771 TCTGATCCACAGAAGTTTCCAGG - Intergenic
1039537377 8:38329488-38329510 TACGATGCACAAAGGGAGCCTGG - Exonic
1041868361 8:62603686-62603708 TCAGATGCACAGATGCTTCCAGG - Intronic
1046139922 8:110078142-110078164 ACTGATGCAGAGAGGCTTCCTGG + Intergenic
1046490332 8:114943819-114943841 TATGGAGCACAGAGGATTTCAGG - Intergenic
1048439288 8:134448041-134448063 CATGATGCCCAGAGGGTCTCTGG - Intergenic
1048945459 8:139443112-139443134 TATGGAGCACACAGGGTTCAGGG - Intergenic
1049291890 8:141807720-141807742 TAAGAAGCACAGAGGGCCCCGGG + Intergenic
1049541047 8:143209148-143209170 AATGGAGCATAGAGGGTTCCAGG + Intergenic
1049696798 8:143987993-143988015 CCTGATGCTCAGAGGGCTCCAGG + Intronic
1060614034 9:124994964-124994986 AATGATGAACAGTGGCTTCCTGG + Exonic
1061549276 9:131323966-131323988 GATGCTGCACAGAAGGTCCCTGG + Intergenic
1186239379 X:7550084-7550106 TATCATTCACAGTGGATTCCTGG - Intergenic
1187594324 X:20755192-20755214 TCTGATACAGAGAGGGGTCCTGG + Intergenic
1188275242 X:28192392-28192414 TCTGGTGCACAGAGGGGTCCTGG - Intergenic
1190164779 X:48064132-48064154 TACCTAGCACAGAGGGTTCCTGG + Intronic
1198618110 X:138480374-138480396 GATGCTGCAGACAGGGTTCCCGG + Intergenic
1199604163 X:149563406-149563428 TATGAAGCACAGAGGTTTGTAGG - Intergenic
1200302461 X:154991271-154991293 TATGTTGCAAAGAGAGCTCCAGG - Intronic