ID: 999692008

View in Genome Browser
Species Human (GRCh38)
Location 5:154156276-154156298
Sequence CCACTGTGTACCCACCAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 503
Summary {0: 1, 1: 2, 2: 13, 3: 68, 4: 419}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999692008 Original CRISPR CCACTGTGTACCCACCAGAA TGG Intronic
900792900 1:4691466-4691488 CCACTGTGTACCCAGCCCAAAGG - Intronic
901135541 1:6991416-6991438 CCACTGTTCACCCATCAGAATGG - Intronic
901608711 1:10479469-10479491 CCAACGTGTACACACTAGAAAGG - Intronic
901719305 1:11183152-11183174 CCACTGCACACCAACCAGAAGGG - Intronic
902210844 1:14903388-14903410 CCCCAGTGTGCCCACCTGAAAGG - Intronic
902270315 1:15299642-15299664 TCACAGGGTCCCCACCAGAAAGG + Intronic
903649519 1:24914343-24914365 CCACTGTCTACCCAGCAGCAGGG + Intronic
903890384 1:26566243-26566265 CCACTCCACACCCACCAGAATGG - Intronic
904648113 1:31983432-31983454 CCACTACGTACCTATCAGAATGG + Intergenic
905049073 1:35033452-35033474 CCACTATGCCCCCATCAGAATGG - Intergenic
905260461 1:36714382-36714404 CCACTTTGCACCCACTAGGATGG + Intergenic
905525618 1:38636597-38636619 ACACTGCAAACCCACCAGAATGG + Intergenic
905593168 1:39182665-39182687 CCACTTCATACCCACTAGAATGG + Intronic
907116561 1:51973809-51973831 CCACTGTCAACCCCTCAGAAGGG + Intronic
907492630 1:54818199-54818221 CCACTAAGTACCCAGCACAAAGG - Intronic
907592653 1:55690573-55690595 CCACTGTGGACACACCAGGATGG - Intergenic
907683682 1:56589001-56589023 CCAATATATACCCATCAGAATGG + Intronic
908289202 1:62645002-62645024 CCACTTTACACCCACTAGAATGG + Intronic
908290373 1:62660431-62660453 CCACTTGGTACCCATTAGAATGG + Intronic
908874527 1:68656053-68656075 CCACTCTGGATCAACCAGAAGGG + Intergenic
909477632 1:76098461-76098483 CCACTGCCTACCTAACAGAATGG - Intronic
912377280 1:109220406-109220428 CCACTATATATCTACCAGAATGG - Intronic
912436173 1:109662700-109662722 CTACTGTATCCCCACTAGAATGG + Intronic
912438225 1:109677136-109677158 CTACTGTATCCCCACTAGAATGG + Intronic
912440739 1:109695608-109695630 CTACTGTATCCCCACTAGAATGG + Intronic
914785700 1:150827855-150827877 CCACTATATACCCACTAGAATGG - Intronic
915183898 1:154087392-154087414 CCACTTTATACCCACTAGGAAGG + Intronic
916710987 1:167408185-167408207 CTACTTTGTACTCACTAGAATGG + Intronic
917382925 1:174434654-174434676 CCAATATATACCCACTAGAATGG - Intronic
917818300 1:178733516-178733538 CCACTGCATACCCACCAGAATGG + Intronic
918089280 1:181274756-181274778 CCACTTCATACCCACTAGAATGG - Intergenic
918457937 1:184744373-184744395 CCACTATACACCCAACAGAATGG + Intronic
918768009 1:188513516-188513538 CCACTATGTACTCATGAGAATGG - Intergenic
918961750 1:191287439-191287461 CCACTGCATACCCACTAGACTGG + Intergenic
919917959 1:202150706-202150728 CCACTGTAGACTCAGCAGAAGGG - Intronic
920358368 1:205393351-205393373 CCACTTTATACCCAGTAGAATGG + Intronic
920418732 1:205815545-205815567 CCACTATACACCCACCAGAATGG - Intergenic
920993280 1:210960932-210960954 CCACTATGTACCTATTAGAATGG - Intronic
921127687 1:212192090-212192112 CCACTATGTACCTATTAGAATGG + Intergenic
921173538 1:212571152-212571174 CCACTGCACACCCAACAGAATGG - Intronic
922164755 1:223105978-223106000 CCACTACCCACCCACCAGAATGG - Intergenic
922369885 1:224898922-224898944 CCACTTTATACCCACTAGGATGG + Intronic
922442675 1:225669512-225669534 CCACTACGTATCCACTAGAATGG - Intergenic
922470022 1:225870833-225870855 GCACTGTGTGCCCTCCAGCATGG + Intronic
922641837 1:227241169-227241191 CCACTACATACCCACTAGAATGG + Intronic
923347932 1:233074873-233074895 TCACTGTATACCCCTCAGAATGG + Intronic
924634607 1:245774241-245774263 CCACTGTCTCCCCAGCAGGATGG + Intronic
1064182269 10:13128371-13128393 CCACTATATACCCTCCAGAGTGG - Intronic
1064250214 10:13700994-13701016 CCACTGTTTAAACACCAAAAAGG + Intronic
1064582017 10:16804268-16804290 CCACTGCATACCCACTAAAATGG + Intronic
1065064453 10:21946430-21946452 CCACTACATACCTACCAGAACGG + Intronic
1065176874 10:23086073-23086095 CCATTTTGTACCCACCACATAGG + Intergenic
1066123555 10:32316153-32316175 CCACTATATGCCCAGCAGAATGG + Intronic
1067320402 10:45214870-45214892 CTACTGCATACCCACTAGAATGG + Intergenic
1070772089 10:79088438-79088460 CCCATGTTTACCCAGCAGAAGGG - Intronic
1070868085 10:79722045-79722067 CCACTTTGTACCTACTAGAATGG + Intergenic
1071226265 10:83532133-83532155 CCACTATATCCCCACAAGAATGG + Intergenic
1071634996 10:87244246-87244268 CCACTTTGTACCTACTAGAATGG + Intergenic
1071660242 10:87493750-87493772 CCACTTTGTACCTACTAGAATGG - Intergenic
1071892186 10:90022217-90022239 CCACTATGCACCCACCAGAATGG + Intergenic
1072056264 10:91760042-91760064 TCACTATATACCCACCAGAATGG - Intergenic
1072137303 10:92559074-92559096 CCACTTCATACCCACCAGGATGG + Intronic
1072667440 10:97404179-97404201 CCACTACACACCCACCAGAATGG + Intronic
1073378041 10:103053904-103053926 CCACTGTGTACACACAAGGGAGG - Intronic
1074031096 10:109689141-109689163 CCACTTTATACTCACTAGAATGG - Intergenic
1074521063 10:114224406-114224428 CCACTGAGTGCCCAGCAAAACGG - Intronic
1074824026 10:117201916-117201938 CCACTGCTGCCCCACCAGAAGGG - Intronic
1075503519 10:123000746-123000768 CCACTAGACACCCACCAGAACGG - Intronic
1075631575 10:124003857-124003879 CGACTGTTTTCCCACCATAAGGG - Intergenic
1076384540 10:130046870-130046892 CCACTCTGTCACCCCCAGAAAGG - Intergenic
1076418714 10:130312512-130312534 CTACTGTATACTCCCCAGAATGG + Intergenic
1076608396 10:131704164-131704186 CCACTCTGTCCCCACCGGGATGG + Intergenic
1076754287 10:132560455-132560477 CCACTGCACACCCACCAGGACGG - Intronic
1077340989 11:2026242-2026264 CCACTGTGTACCCACCCCGGGGG + Intergenic
1077427088 11:2486186-2486208 CCACTGCACACCCACTAGAATGG - Intronic
1077547119 11:3178141-3178163 GCACTATGCACCCACTAGAATGG + Intergenic
1077817464 11:5699750-5699772 CCATTATGTTCCCACTAGAAAGG - Intronic
1077951408 11:6961898-6961920 CCAATGTTTCCCCAACAGAAAGG + Intronic
1078193872 11:9118434-9118456 CCACTGGATTCCCACCAGAATGG + Intronic
1078194797 11:9126885-9126907 CCACTTTATACCCACTAGAATGG - Intronic
1078887206 11:15513778-15513800 CTACTAGATACCCACCAGAATGG - Intergenic
1080021494 11:27565123-27565145 CCATTGAAAACCCACCAGAAAGG + Intergenic
1080572949 11:33572981-33573003 CCACTCTATACCCACCAGCACGG - Intronic
1080615545 11:33942024-33942046 CCACTGTGGCCCCACTAGCAGGG - Intergenic
1081675567 11:44967087-44967109 CCCCTGTGCAGGCACCAGAATGG - Intergenic
1082208773 11:49470995-49471017 CCACTATATAACCACCAGCATGG - Intergenic
1083357653 11:62079035-62079057 CCACTTTTCACCCACCAAAATGG - Intergenic
1084135673 11:67179086-67179108 CCACTTTATACCCACCAGAACGG - Intronic
1084895112 11:72260855-72260877 TCACTATGTACCTACTAGAATGG - Intergenic
1084918877 11:72452951-72452973 CAACTCTGTACCCACCAAAATGG + Intergenic
1085499913 11:77010635-77010657 CCACTGGATACCCAGCACAATGG + Intronic
1085749212 11:79145816-79145838 CTACTATGTACTCATCAGAATGG - Intronic
1085762468 11:79254034-79254056 CCAGTGTTTACCCACAGGAAAGG + Intronic
1086007945 11:82062643-82062665 CTACTCTATACCCACCAAAATGG - Intergenic
1086116084 11:83252208-83252230 CCAATATATACCCATCAGAATGG + Intronic
1086191721 11:84087340-84087362 CCACTTTATACCCACAAGAATGG - Intronic
1086640844 11:89154210-89154232 CCACTATATACCCACCAGCATGG + Intergenic
1088476325 11:110243309-110243331 TCACTATATACTCACCAGAATGG + Intronic
1089111089 11:116057290-116057312 CCTCTTTTTACCCACAAGAATGG - Intergenic
1089686505 11:120151751-120151773 CCACTGTACAACCACTAGAATGG - Intronic
1090022707 11:123141904-123141926 CCACTGTGGCCCCAGCAGATGGG + Intronic
1090466178 11:126936195-126936217 CCACTTCATACCCACTAGAATGG + Intronic
1090760246 11:129830753-129830775 CCACTTCATACCCACTAGAATGG + Intronic
1202823974 11_KI270721v1_random:81431-81453 CCACTGTGTACCCACCCCGGGGG + Intergenic
1092836937 12:12499351-12499373 GCATTGTGACCCCACCAGAAAGG + Intronic
1093002928 12:14018587-14018609 CCACTAGAGACCCACCAGAATGG - Intergenic
1094311122 12:29084900-29084922 CCACAGTATACCTACTAGAATGG + Intergenic
1095859367 12:46898731-46898753 CCACTTCATACCCACTAGAATGG + Intergenic
1096349695 12:50885991-50886013 CCACTGCGCACCCACAAGGATGG - Intronic
1100129451 12:91473182-91473204 CCACTATATACCTACCAGGATGG - Intergenic
1102592604 12:113968266-113968288 CCACTGTACACCCACTAGAGTGG - Intergenic
1102819648 12:115896901-115896923 CTACTATCTACCCACCAGAAGGG + Intergenic
1103278346 12:119733116-119733138 CCACTGTGGCCCCACAGGAAGGG + Intronic
1104126906 12:125856291-125856313 CCATTGTGTATCCTCCAGCATGG - Intergenic
1104663798 12:130633373-130633395 CCAAACTGTTCCCACCAGAACGG + Intronic
1104804840 12:131579148-131579170 CCACCCTGCACCCATCAGAAAGG + Intergenic
1105531295 13:21222929-21222951 ACACTTTGTACCCACAAGGATGG + Intergenic
1105763537 13:23535062-23535084 TCACTGTGTCCCCAGCAGAGTGG - Intergenic
1106000267 13:25716009-25716031 CCACTTTATACCCACTAGGATGG - Intronic
1106000891 13:25722159-25722181 CCACTGCATACCCACTAGGATGG - Intronic
1106185959 13:27410218-27410240 CCACTTTGTACCCAGCTCAATGG + Intergenic
1106261525 13:28071414-28071436 CCACTGAGTACCCAGCACAATGG - Intronic
1107062761 13:36177603-36177625 CTACTGTGTATGCCCCAGAAAGG - Intronic
1107989534 13:45806024-45806046 CCATTTTGTCCCCATCAGAATGG + Intronic
1108012533 13:46034106-46034128 CTACTATATACCCACTAGAAGGG + Intronic
1108444785 13:50497294-50497316 CCTCTGTGTAGCCAACAGAAGGG - Intronic
1108819575 13:54331675-54331697 CCACTGTGTCCCTATTAGAATGG + Intergenic
1110205872 13:72912477-72912499 CCACTGTATACCCACAAGAATGG + Intronic
1112088898 13:96061016-96061038 CCAATGTGTTCCCACCAGTTTGG - Intergenic
1112114099 13:96334017-96334039 CCACAGTGTACCCACCCTACAGG - Intronic
1112267609 13:97939508-97939530 CAATTATGCACCCACCAGAATGG - Intergenic
1113279873 13:108777594-108777616 CCACTGGGTACCCACCACAGTGG + Intronic
1113792878 13:113039746-113039768 CCACTCTGTATCCACAAGAGTGG + Intronic
1113945439 13:114041413-114041435 CCACTGTGTCCCTTCCAGTAAGG + Intronic
1115241260 14:31252834-31252856 CCACTGTCCACCCATCAGACTGG - Intergenic
1115456244 14:33607026-33607048 CCACTGTGTACCTATTAGAATGG + Intronic
1115718954 14:36138626-36138648 CCACTACATACCCACTAGAATGG + Intergenic
1115729440 14:36252497-36252519 CCACTAGGTATTCACCAGAATGG + Intergenic
1117870574 14:60196503-60196525 TCACTCTATACCTACCAGAAGGG + Intergenic
1117922804 14:60743154-60743176 CCACTTCATACCCACTAGAATGG - Intronic
1118051482 14:62034154-62034176 CCACCTTGTACCCACCAGCAAGG + Intronic
1118141379 14:63087007-63087029 CCACTTCGCACCCACCAGAGTGG + Intronic
1118324090 14:64769781-64769803 CCTCTGTGTCCCAACCAGAGGGG + Intronic
1118334230 14:64838688-64838710 CCACTCTATACCTATCAGAACGG + Intronic
1118784096 14:69031345-69031367 CCACTGTCCACCCACTAGAATGG + Intergenic
1118785149 14:69039442-69039464 CCACTGTGTTTCCACAGGAAGGG + Intergenic
1119058811 14:71452721-71452743 CCACTTCATACCCACCAGAATGG - Intronic
1119108667 14:71949356-71949378 TCACTACGCACCCACCAGAATGG - Intronic
1119273250 14:73328594-73328616 CCACTATGTACCTATTAGAATGG - Intronic
1122376411 14:101262607-101262629 CCACTGCATACCCACTAGAATGG - Intergenic
1123975230 15:25547252-25547274 CCACTATATACCCCCTAGAATGG - Intergenic
1124266839 15:28243682-28243704 CCAGTGTACACCCACCAGAATGG + Intronic
1124389087 15:29237615-29237637 CTACTTTGTACCCACTAGGATGG + Intronic
1124406320 15:29395480-29395502 CCACTTCCTACCCATCAGAATGG - Intronic
1124682416 15:31745988-31746010 CCACTTGATACCCACTAGAATGG + Intronic
1125398915 15:39279376-39279398 CCACTATACACCCACTAGAATGG + Intergenic
1126093491 15:45071516-45071538 CCACTGTTTAGCACCCAGAATGG + Intronic
1127627718 15:60796473-60796495 CCACTTTATACCCACTAGGATGG + Intronic
1127957578 15:63866210-63866232 TCACTGCGTGCCCAGCAGAAAGG + Intergenic
1128021680 15:64396931-64396953 CCACTAAATACCAACCAGAATGG - Intronic
1128035819 15:64525009-64525031 CCACTTTACACCCACCAGGATGG - Intronic
1128560550 15:68663963-68663985 CTACTGTACATCCACCAGAAAGG + Intronic
1130554709 15:84914658-84914680 CCACTGTGTGCCAACCACGAGGG - Intronic
1130565470 15:84990920-84990942 CCACTACACACCCACCAGAATGG - Intronic
1132270824 15:100523016-100523038 CCACTACACACCCACCAGAAAGG - Intronic
1132325728 15:100968517-100968539 CCACTATGCTCTCACCAGAATGG - Intronic
1132326869 15:100977714-100977736 TCCCTGTTTACCCACCAGAGTGG + Intronic
1132896086 16:2230029-2230051 CCACCAGGCACCCACCAGAATGG + Intronic
1134109959 16:11509039-11509061 CACCTATGTACCCACCAGCAGGG + Intronic
1134278051 16:12794125-12794147 CCACTGTGAAGCTGCCAGAATGG + Intronic
1134758562 16:16692540-16692562 CCACTACATACCCACTAGAATGG - Intergenic
1134987510 16:18666641-18666663 CCACTACATACCCACTAGAATGG + Intergenic
1135805997 16:25543200-25543222 CCACTGTGTCCCTACCACCAAGG + Intergenic
1136252679 16:29016347-29016369 CCACTCTATACCCACTAGAATGG - Intergenic
1137884763 16:52090959-52090981 CCACTATGCACCCACCAGTTTGG + Intergenic
1138168676 16:54828277-54828299 CCACTACATACCCACTAGAATGG - Intergenic
1138848186 16:60593165-60593187 CCACTGTATTCACACCTGAAGGG - Intergenic
1140417100 16:74783202-74783224 CCAATATTTACCCACCAGGATGG - Intergenic
1140840714 16:78836439-78836461 CTACTGTGGACCCACCTGAAGGG + Intronic
1141418277 16:83894205-83894227 ACACTGTGTCCCCACCCAAAAGG + Intergenic
1141871102 16:86786694-86786716 ACACTGTATACCCACCAACAGGG + Intergenic
1142820744 17:2465217-2465239 CCACTTTTTACCCACTAGGATGG + Intronic
1143302434 17:5920804-5920826 CCACTGTGCATCGATCAGAATGG + Intronic
1143690198 17:8556091-8556113 CCACTATATACCCACTAGAGTGG + Intronic
1144298048 17:13898034-13898056 TCACTATACACCCACCAGAATGG + Intergenic
1144500435 17:15782161-15782183 TCACTATATACTCACCAGAATGG - Intergenic
1144748266 17:17630507-17630529 CCACTTTGTGCCCACTAGGATGG - Intergenic
1145853525 17:28128609-28128631 ACACTATGTACCCAACAGATTGG + Intronic
1146413314 17:32608427-32608449 CCACTGCAAACCCATCAGAATGG + Intronic
1146576283 17:33994725-33994747 TGACTGTGAACCCACTAGAAAGG + Intronic
1146600206 17:34207692-34207714 CCACTTCGTACCCACAAGAAGGG - Intergenic
1146779490 17:35655824-35655846 CCACTATACACTCACCAGAATGG - Intronic
1147438993 17:40436033-40436055 CCACTCCATACCCACCAGATGGG - Intergenic
1147898774 17:43769918-43769940 CCACTGTGTGCCTGTCAGAATGG + Intronic
1150023713 17:61648887-61648909 CCACTATACACCCACCAGAATGG - Intergenic
1150179160 17:63096906-63096928 CCACTTTATACCCACTAAAATGG - Intronic
1150194589 17:63282676-63282698 ACGCTGTGTACCAACAAGAATGG - Intronic
1152331495 17:79675797-79675819 CCACTGCATACCCACTAGCATGG + Intergenic
1152443107 17:80321690-80321712 CCACTTCATACCCACCAGGATGG - Intronic
1152501444 17:80712855-80712877 CTACTACATACCCACCAGAATGG - Intronic
1152764616 17:82129279-82129301 CCACAGTCTTCCCTCCAGAAGGG - Intronic
1153253548 18:3148035-3148057 CCACTATGAACCCACTAGAATGG + Intronic
1153600643 18:6777929-6777951 CCCCAGTGTAGCCACCAGATCGG - Intronic
1153767829 18:8391058-8391080 CCACTGTGTACTCACCAGAATGG + Intronic
1153870697 18:9316905-9316927 CCACTATACACCCACTAGAATGG + Intergenic
1154088408 18:11330946-11330968 CCATTGTATACCTATCAGAATGG - Intergenic
1156210875 18:34941073-34941095 CCACTGCATACCCATTAGAATGG + Intergenic
1156262132 18:35454822-35454844 CTACTTTACACCCACCAGAATGG + Intronic
1156353912 18:36324666-36324688 CTACTGCATACCCACCAGAATGG + Intronic
1157225445 18:45859009-45859031 CCCCAGCGTAGCCACCAGAAAGG + Intronic
1157323532 18:46652512-46652534 CTGCCATGTACCCACCAGAATGG + Intronic
1158183076 18:54739805-54739827 CCACTACATACCCACTAGAAGGG - Intronic
1159068777 18:63598937-63598959 CCACTTTGTACCTACAAAAATGG - Exonic
1159397220 18:67875781-67875803 CCTCTCTATACCCATCAGAATGG + Intergenic
1159443036 18:68506332-68506354 CCTCTGTGTACCCACTAAATAGG + Intergenic
1159991385 18:74913011-74913033 CCATTGTTTACCCACCACATGGG + Intronic
1160170887 18:76553260-76553282 CTACTTTATACCTACCAGAATGG + Intergenic
1161148668 19:2695169-2695191 CCTCTGTGTACCCACCAAGATGG + Intronic
1162124072 19:8490009-8490031 CCACTGTGTGCCAATCAGGAGGG + Intergenic
1163191457 19:15679843-15679865 CCTCTGTGTACCCCACAGACAGG - Intronic
1163756429 19:19109197-19109219 CCACTGTGCAGCCACTAAAAAGG - Intronic
1164560055 19:29285032-29285054 CCATTTTGCACCCACCAGGATGG + Intergenic
1164605999 19:29598567-29598589 ACACTGTGTCCAGACCAGAAAGG + Intergenic
1165066120 19:33229559-33229581 CCACTGAGTAGCCACCAAAATGG + Intergenic
1165703431 19:37956199-37956221 CCACTGCACACCCACCAGGATGG - Intronic
1165990385 19:39808612-39808634 CTACTATGTACCCACAAAAATGG + Intergenic
1166774576 19:45304604-45304626 CCACTGTGTCCCCAGCACAGAGG - Intronic
1166784388 19:45358984-45359006 CCACTGTGTCCCCAGCACAGAGG - Intronic
1167892193 19:52549386-52549408 CCCCTGTGTAGATACCAGAAAGG - Intronic
925028306 2:626819-626841 TCACTGTGTACCCCCAAGATGGG - Intergenic
927063877 2:19449996-19450018 CTACTGTGTACTTACTAGAAAGG + Intergenic
927462026 2:23307457-23307479 CCACTCTGCACCCATCAGAAGGG + Intergenic
927517980 2:23683001-23683023 CCAGTGTGTCCTCACCAAAAAGG + Intronic
927728625 2:25449515-25449537 CCACTGTATACCCACCAGAATGG - Intronic
928013661 2:27634089-27634111 CCACTCTATATCCACTAGAATGG - Intronic
928307768 2:30184759-30184781 CCACTATATGCCCATCAGAAAGG + Intergenic
929521674 2:42658137-42658159 CCACTGCCAATCCACCAGAATGG + Intronic
929993454 2:46809646-46809668 CCATTTTGTACCCCCCAGATTGG + Intergenic
930497263 2:52161794-52161816 CCACTTTACACCCACCAGAATGG - Intergenic
931314244 2:61112268-61112290 ACACTATCTACCCACTAGAATGG - Intronic
931733394 2:65172971-65172993 CCACTTCATACCCAGCAGAATGG - Intergenic
932341902 2:70968216-70968238 CCACTTTGTACCCACTAATATGG - Intronic
932512661 2:72310325-72310347 CCACTTTATACCCACCAGGTTGG - Intronic
933845600 2:86324444-86324466 ACACTTGGTACCCATCAGAATGG + Intronic
934042553 2:88140276-88140298 CCACTTTATACCCACTAGAATGG - Intergenic
934528206 2:95065846-95065868 CCATTATGTACCCATAAGAATGG - Intergenic
934785653 2:97003689-97003711 CCACTTTATACCCACTAGGATGG - Intronic
936704223 2:115052628-115052650 CCACTTCATACCCACTAGAATGG + Intronic
937233217 2:120414263-120414285 CCACTTTGTATCCATCAGAATGG + Intergenic
937836700 2:126478536-126478558 CCACTGCACACCAACCAGAATGG + Intergenic
937844893 2:126568924-126568946 CCACTTTGCACCCACTAGGATGG + Intergenic
938739292 2:134215891-134215913 CCACTACATACTCACCAGAATGG - Intronic
939797084 2:146658645-146658667 CCACTCTGTACCCACTAGGATGG + Intergenic
940949150 2:159652533-159652555 CCACTTTGTGCCCACTAGATTGG - Intergenic
942167663 2:173257842-173257864 CCACTATACACCCATCAGAATGG - Intronic
942201476 2:173575876-173575898 CCACAGTGAGCCCACCAGCAGGG - Intergenic
942687625 2:178550040-178550062 CCACTGTGTATACACCACGATGG + Exonic
943068363 2:183112823-183112845 TCACTACATACCCACCAGAATGG + Intergenic
943542633 2:189236548-189236570 CCACTCTACACCCACCAGACTGG - Intergenic
943582448 2:189700892-189700914 CCATTGTGTATCCATCTGAATGG + Intronic
944332778 2:198491399-198491421 CCACTATGTACCCACTAGAATGG + Intronic
944700407 2:202240829-202240851 CCACTTTATACCCACTAGAAGGG + Intergenic
946786810 2:223255353-223255375 CCACTTTGCAACCACTAGAATGG - Intergenic
947055615 2:226098315-226098337 TCACTGCATACCCACTAGAATGG + Intergenic
947183844 2:227437192-227437214 CCACTGTGTACCAACCAAAATGG - Intergenic
947540134 2:230971403-230971425 CCACTTCATACCCACTAGAATGG + Intergenic
948363760 2:237441199-237441221 CCAACGTTTACCCATCAGAAGGG + Intergenic
948804586 2:240448019-240448041 ACACTGTGTTCCACCCAGAATGG - Intronic
1169423691 20:5479955-5479977 CCACTTTATACCCCCTAGAATGG + Intergenic
1171455199 20:25266811-25266833 CCGCTGTATTCCCACAAGAATGG + Intronic
1174409639 20:50326260-50326282 CCACTGTACACCCACTAGAATGG - Intergenic
1175420234 20:58827382-58827404 CCAGTGTGTCCCCACCAGCAGGG - Intergenic
1175519772 20:59593192-59593214 CCACTGCACACCCATCAGAATGG - Intronic
1175622605 20:60462301-60462323 CCACTCTGTACCCACTAAGATGG + Intergenic
1175655139 20:60763461-60763483 CCAACGTGTATCCACCAGCACGG - Intergenic
1175832249 20:61971786-61971808 CCACTGTGTGCCCACCCTCAGGG - Intronic
1176365925 21:6032820-6032842 CCACTGTGCACCCACCAGATTGG + Intergenic
1176997500 21:15573472-15573494 CCATTGCCCACCCACCAGAACGG + Intergenic
1177780478 21:25617487-25617509 CTACTTTATACCCACTAGAATGG + Intergenic
1178421658 21:32448145-32448167 GCACTGTGGACCAAACAGAATGG + Intronic
1178928000 21:36791960-36791982 CCACTGTGAAGCCATCAGAAAGG + Intronic
1179100012 21:38348180-38348202 CCACTGTTCAGCCACAAGAATGG + Intergenic
1179757591 21:43505725-43505747 CCACTGTGCACCCACCAGATTGG - Intergenic
1181466392 22:23112836-23112858 CCAGTGTGGACCCATCAGGAAGG + Intronic
1181635244 22:24171439-24171461 CCACTGAGTCCCCACCAGTACGG + Intronic
1182208041 22:28648296-28648318 CCACTGTATCCCAGCCAGAATGG + Intronic
1182317845 22:29459792-29459814 CCACTCGGTTCCCAGCAGAAAGG + Intergenic
1182405625 22:30126874-30126896 CCACAGCACACCCACCAGAATGG - Intronic
1184053224 22:42024529-42024551 CCACTTCATACCCACTAGAATGG - Intronic
1184448524 22:44568799-44568821 CCACTACATATCCACCAGAATGG + Intergenic
1184568053 22:45304879-45304901 CCACTATACACCTACCAGAATGG - Intergenic
949429003 3:3952818-3952840 CTGCTGTGTAACTACCAGAATGG + Intronic
950963059 3:17125749-17125771 CTTCCATGTACCCACCAGAATGG - Intergenic
951746112 3:25979470-25979492 TCACTTTGTAGCCACTAGAACGG + Intergenic
952443068 3:33353084-33353106 CCACTGTATACCTATTAGAATGG + Intronic
952504260 3:33993739-33993761 TTACTTTATACCCACCAGAATGG - Intergenic
952504347 3:33994620-33994642 CCACAGCATACCCACCAAAATGG + Intergenic
953445869 3:42965985-42966007 CCACTATATCCCTACCAGAATGG - Intronic
953452156 3:43014393-43014415 CCAGTGTGAAGCCACAAGAAGGG + Intronic
953971285 3:47349492-47349514 CCACTTTGCATCCACTAGAATGG - Intergenic
954686816 3:52375480-52375502 CAACTGGGTGGCCACCAGAAAGG + Intronic
955098076 3:55819873-55819895 CCAAATTGTACCCACAAGAAAGG - Intronic
955947163 3:64206474-64206496 CCACTGGGTACCCAGCTGAGTGG - Intronic
956462898 3:69489539-69489561 CTACTTTATACCCACTAGAATGG + Intronic
956602296 3:71034892-71034914 CCACTGGGGAGCCACCAGACAGG - Intronic
956812222 3:72874672-72874694 CTACTACATACCCACCAGAATGG + Intergenic
958264997 3:91427598-91427620 CCACTGGCTACCCACCAGAATGG - Intergenic
959078053 3:101771982-101772004 CTACTATGTATCCACTAGAATGG - Intergenic
959253970 3:103986785-103986807 CCACTATGTACCCACAATGATGG - Intergenic
960843254 3:121981686-121981708 CCACTTCATAGCCACCAGAATGG - Intergenic
960878451 3:122320299-122320321 ATACTGTATACCCACAAGAATGG + Intergenic
961071825 3:123937354-123937376 CCACTGCATACCCATTAGAATGG - Intronic
961784806 3:129341356-129341378 CCCCTGGGTACCCAGCAGAGAGG + Intergenic
962446022 3:135466268-135466290 CTACTTTGTATCCACCAGAATGG + Intergenic
966332492 3:178829973-178829995 CCACCGTGTAACCACCTTAAGGG + Intronic
968435232 4:582223-582245 ACACTGCAAACCCACCAGAATGG - Intergenic
968781474 4:2585412-2585434 CCACCATTTACCCACCAGAGAGG - Intronic
969723252 4:8904964-8904986 CCCCTGTGCACCCCCAAGAAGGG + Intergenic
969951585 4:10842043-10842065 CCACTCTGTGTCCACCAAAATGG - Intergenic
973373529 4:49271748-49271770 CCACTCTGCACCCACAAGTAAGG + Intergenic
973387484 4:49523460-49523482 CCACTCTGCACCCACAAGTAAGG - Intergenic
974495777 4:62624697-62624719 CCACTTTGTACCCACTGGGATGG + Intergenic
975641055 4:76500643-76500665 CTACTGTGTACCCACTAGAATGG - Intronic
975797504 4:78024240-78024262 CCACTGTACAGCCATCAGAATGG - Intergenic
975995443 4:80308578-80308600 CCCCTCTTTACCCTCCAGAAAGG + Intronic
976350919 4:84059095-84059117 AAACTGTGAACCCCCCAGAAAGG - Intergenic
976562275 4:86515523-86515545 CCACTTTATTCCCACAAGAATGG - Intronic
976756430 4:88502713-88502735 CTACTATATACCCACCAGAATGG - Intronic
978492171 4:109321062-109321084 CCACTGTTCACCTACCACAATGG + Intergenic
978802881 4:112771961-112771983 CCACTCTGTACCCAGAGGAAAGG - Intergenic
979492059 4:121339567-121339589 CCCTTGTGTACTCACCACAAGGG + Intronic
980001349 4:127492652-127492674 CCACTATATACCTACTAGAATGG + Intergenic
981053609 4:140336927-140336949 CCACTTTATACCCACTAGGATGG - Intronic
981291061 4:143075646-143075668 CCACTGTATACCCAACATATGGG - Intergenic
982858927 4:160423531-160423553 CCACTGTCTTCCAACCACAATGG + Intergenic
983415466 4:167447316-167447338 CAACTGTATACCCACAACAAAGG - Intergenic
984577169 4:181464339-181464361 CCACTACATACCCACCAGAATGG - Intergenic
984668529 4:182455261-182455283 CCACTCTGTTCCCACCATCAGGG + Intronic
985641534 5:1065572-1065594 CCCCTGTGGACCCAGCAGGAGGG + Intronic
986239489 5:5945323-5945345 CCACTTTATACTCACGAGAATGG - Intergenic
986942966 5:12979020-12979042 CTACTGTGTACCCTGCAAAACGG + Intergenic
987385795 5:17328203-17328225 CCACTCCACACCCACCAGAATGG + Intergenic
987588954 5:19897378-19897400 CCACTATATACTCAGCAGAATGG + Intronic
989354002 5:40520679-40520701 CCATTGTGTACCCAACTGCAAGG + Intergenic
991055996 5:62321450-62321472 CCACTTCATACCCACCAGGACGG - Intronic
991140554 5:63235982-63236004 CCACTTTATACCCACTAGAATGG - Intergenic
991952945 5:71964593-71964615 TCACTGCATACCCATCAGAATGG + Intergenic
991952948 5:71964629-71964651 TCACTGCATACCCATCAGAATGG + Intergenic
992099799 5:73396051-73396073 GCACTGTGTTCCAACAAGAATGG + Intergenic
992189388 5:74276262-74276284 TCACTGTTTACCCAGCAGCAGGG - Intergenic
994654547 5:102574415-102574437 CCACTTTATACCCACTAGAATGG - Intergenic
995085957 5:108109332-108109354 CCACTCTATATCCACAAGAAAGG + Intronic
995139866 5:108723333-108723355 CCACTACAAACCCACCAGAATGG + Intergenic
995654958 5:114415579-114415601 CCACTTTATACTCACTAGAATGG - Intronic
996102579 5:119459642-119459664 CTACAGAGTCCCCACCAGAAAGG - Intronic
996320806 5:122213112-122213134 CAACTATGTACTCACTAGAATGG - Intergenic
996360789 5:122643548-122643570 CCACTATGTACCTATTAGAATGG + Intergenic
997306734 5:132842807-132842829 CCACTTCATACCCACTAGAATGG + Intergenic
997495911 5:134325637-134325659 CCACTATATAACCACCAGAATGG - Intronic
997728895 5:136149505-136149527 TCACTCGGTACCTACCAGAATGG - Intronic
999183175 5:149684718-149684740 CCACTGTGTACCTATCAGAATGG - Intergenic
999439345 5:151589575-151589597 GCTCTGTCTACCCAACAGAATGG + Intergenic
999692008 5:154156276-154156298 CCACTGTGTACCCACCAGAATGG + Intronic
999903859 5:156117858-156117880 CCACTGTGAACACACAAAAAAGG - Intronic
1000467131 5:161593505-161593527 CTACTACATACCCACCAGAATGG + Intronic
1000733833 5:164873348-164873370 CCACTGTGCACCTATTAGAATGG + Intergenic
1000808002 5:165821489-165821511 CCACTTTTTACCCATTAGAATGG - Intergenic
1001807701 5:174602125-174602147 CCACTACATACCCACTAGAATGG - Intergenic
1002460178 5:179369432-179369454 CCCCTGTGTGCCCCCCAGATGGG + Intergenic
1003694112 6:8385772-8385794 CCATTGTATACCTATCAGAATGG + Intergenic
1005262852 6:24080225-24080247 ACCCTGTGTACCCATCAGGATGG - Intergenic
1008990385 6:57595063-57595085 CCATTGGCTACCCACCAGAATGG + Intronic
1009178962 6:60493610-60493632 CCACTGGCTACCCACCAGAATGG + Intergenic
1009996700 6:70903696-70903718 CCACTACTGACCCACCAGAATGG + Intronic
1010058676 6:71595759-71595781 CCACTATGTATCGACTAGAATGG - Intergenic
1010711033 6:79174338-79174360 CCTCTGGGAACCCACCAGAGTGG + Intergenic
1011269778 6:85566079-85566101 CCACTGTTAACCCTACAGAAGGG + Intronic
1011747874 6:90424347-90424369 GCACTGCATACCCACTAGAATGG - Intergenic
1013502670 6:110768191-110768213 CCACTGTACACCCACTAGCATGG + Intronic
1015246324 6:131078659-131078681 CCACTATGTAGCCACCAAAATGG + Intergenic
1015807467 6:137125758-137125780 TGACTTAGTACCCACCAGAATGG + Intergenic
1016395501 6:143619505-143619527 ACACTGTGTACCCTTCAGTAGGG - Intronic
1016766687 6:147802361-147802383 CCACTGTGAAAACACTAGAATGG + Intergenic
1016937583 6:149458778-149458800 CCATTTTGTGCCCACCAGATTGG - Intronic
1017068794 6:150553593-150553615 CCACTGCACACCCAACAGAATGG - Intergenic
1018585758 6:165356279-165356301 CCATTATGCACCCACTAGAATGG - Intronic
1018725162 6:166606789-166606811 CCACTTCATACCCACCAGGATGG + Intronic
1018912517 6:168110796-168110818 CCACCGTGTCCCCAGCAAAAGGG + Intergenic
1019031933 6:169021042-169021064 CCCCTTTGTACCCTCCAGGAAGG - Intergenic
1019845895 7:3500638-3500660 CCACTGAGTACCGAGCACAAAGG - Intronic
1021020465 7:15592042-15592064 CCACTTTATACCCACAAGAATGG + Intergenic
1021507475 7:21401610-21401632 CCAATGTGTGCCCAGCAGAATGG - Intergenic
1021552808 7:21889585-21889607 CCACTGTACCTCCACCAGAATGG - Intronic
1022116555 7:27266075-27266097 CCACTATATACCTACTAGAATGG - Intergenic
1022236159 7:28462607-28462629 CCACTTCATACCCACTAGAATGG - Intronic
1022371238 7:29773537-29773559 CCACTACTCACCCACCAGAATGG + Intergenic
1022487132 7:30787743-30787765 CCACAGTGTCCCCAGCAGATGGG - Intronic
1023076848 7:36492082-36492104 CCCCTACGTACCCACCAGTATGG - Intergenic
1023668294 7:42548849-42548871 CCGCTGCACACCCACCAGAATGG + Intergenic
1024142214 7:46473308-46473330 CCACTTTGTACTCATTAGAATGG - Intergenic
1024521561 7:50308973-50308995 CCACTGTGGAAACACCAGCAGGG - Intronic
1025172203 7:56769619-56769641 CCATTATGTACCTACCAGAATGG + Intergenic
1025699662 7:63805936-63805958 CCATTATGTACCTACCACAATGG - Intergenic
1025831699 7:65056890-65056912 CCATTATGTACCTACCAGAATGG - Intergenic
1025918838 7:65890787-65890809 CCATTATGTACCTACCAGAATGG - Intronic
1026814817 7:73502407-73502429 CACCTGTGTACCCACCATACAGG + Intronic
1028492635 7:91430107-91430129 CTACTACATACCCACCAGAACGG + Intergenic
1028969732 7:96845482-96845504 TCACTATATACCTACCAGAATGG + Intergenic
1029277528 7:99416025-99416047 CCACTTTATACCCACTAGGATGG - Intronic
1029427469 7:100505225-100505247 CCACTTTGTACTCAGCAGGATGG + Intergenic
1029705529 7:102273878-102273900 CCACTGTGGACTCTACAGAATGG - Intronic
1030014779 7:105208099-105208121 CCACTTCATACCCACTAGAATGG + Intronic
1030367853 7:108666374-108666396 CCACTGTTGATCCACTAGAATGG - Intergenic
1030434257 7:109495342-109495364 CCATTTTCTACCCACTAGAATGG - Intergenic
1030499596 7:110342906-110342928 ATACTGTGTACTCTCCAGAAAGG - Intergenic
1031241286 7:119243889-119243911 TCACTTTCTACCCACCAAAATGG - Intergenic
1031577845 7:123437694-123437716 CCATTGAGTAAGCACCAGAAAGG + Intergenic
1031900178 7:127400398-127400420 CCACTATATACCCAGCAGAATGG + Intronic
1032553197 7:132805094-132805116 CCACTGTGTACAGACTAGGAAGG + Intronic
1033323481 7:140360949-140360971 CCACTGCATACCCACCCTAAGGG + Intronic
1035150484 7:156867219-156867241 CCACTTCATACCCACTAGAATGG + Intronic
1036429021 8:8672492-8672514 CCACTGTACACCAACTAGAATGG + Intergenic
1038424350 8:27454714-27454736 CCACTGAGTCCCCACCAGGTGGG + Intronic
1039547740 8:38421786-38421808 ACAGTGTGTACCTTCCAGAACGG + Exonic
1040417340 8:47207005-47207027 CCACTGAGGACCCCACAGAAAGG - Intergenic
1040425155 8:47278122-47278144 CCACTTCACACCCACCAGAATGG - Intronic
1041548574 8:59075378-59075400 CCACTGTATACCCAGAGGAAAGG + Intronic
1041791824 8:61704775-61704797 CCACGGCATACCCACCAGAATGG + Intronic
1041955069 8:63549603-63549625 CCACTATTTACCCACTAGAATGG - Intergenic
1042614928 8:70638308-70638330 CCAATCCTTACCCACCAGAATGG - Intronic
1042628032 8:70781101-70781123 CCACTTTATACCCACTAGGATGG - Intronic
1043329583 8:79098649-79098671 CCACTGTATATCCACTAGGATGG + Intergenic
1043721534 8:83550736-83550758 CCATTGAGCACCCACCAGCATGG + Intergenic
1044593311 8:93934988-93935010 CCACTTTATACCCACTAGAGTGG - Intergenic
1045133702 8:99188759-99188781 CCACTTCATACCCATCAGAAGGG - Intronic
1045589238 8:103575245-103575267 CTACTGTGTGCCCACTAGAGTGG + Intronic
1046360187 8:113143272-113143294 ACACTATATATCCACCAGAATGG + Intronic
1047266401 8:123313712-123313734 CCACTTTGTACCCACCTGCATGG + Intergenic
1047531149 8:125677275-125677297 CCATTGTGTATGCACCAAAATGG + Intergenic
1047999840 8:130369673-130369695 CCACTTTGCACCCACTAGGATGG + Intronic
1048470887 8:134703187-134703209 CTACTACGTACCCACTAGAATGG - Intronic
1048652870 8:136499241-136499263 CCACAGTATATCTACCAGAATGG - Intergenic
1049028804 8:140016977-140016999 CTACTATATACCCACTAGAATGG - Intronic
1050465890 9:5922991-5923013 CCAGTGTCTACTCTCCAGAAAGG - Exonic
1050648715 9:7751485-7751507 CCACTTTATACCTACTAGAAAGG + Intergenic
1051075534 9:13230140-13230162 TCACTGCGTACCTATCAGAATGG + Intronic
1051128969 9:13837375-13837397 CCACTACATACCCACCAGAAAGG - Intergenic
1051488975 9:17639481-17639503 CAACTGTATACCCACTGGAATGG + Intronic
1051601987 9:18884105-18884127 CCACTGCATACCCACCAGGATGG - Intronic
1052394189 9:27917884-27917906 CCACTCCACACCCACCAGAATGG - Intergenic
1052897866 9:33764950-33764972 CCACTTCATACCCACTAGAATGG + Intronic
1053454605 9:38224171-38224193 CCACTGTGTACTTATCAGAAAGG + Intergenic
1054351440 9:64020585-64020607 CCACTCTGCACCCACAAGTAAGG - Intergenic
1055092132 9:72373730-72373752 CCACTATGTACCTATTAGAATGG + Intergenic
1057718207 9:97512221-97512243 CCACTACCTGCCCACCAGAATGG + Intronic
1057992979 9:99792185-99792207 CCATTTTATACCCACTAGAAAGG - Intergenic
1059292106 9:113235273-113235295 TCAATTTATACCCACCAGAATGG + Intronic
1060112907 9:120919372-120919394 CCACTGTGACCCCACCACAAAGG - Intronic
1060322274 9:122573434-122573456 CCACTGTATACCCATTAGAATGG - Intergenic
1060856365 9:126916838-126916860 CCACTGTGTACCCACAGGGGCGG + Intronic
1061557358 9:131379480-131379502 CAACTTTGTACCCACTAGCATGG - Intergenic
1061827626 9:133271286-133271308 CCACCTTTTACCCACAAGAATGG + Intronic
1186265327 X:7826664-7826686 CCACTCTGTACCCACTAGTCTGG + Intergenic
1186439662 X:9574802-9574824 GCACTGTGTACCCAGCACCATGG + Intronic
1186713306 X:12223741-12223763 CCACTTAATACCCACTAGAATGG - Intronic
1186725378 X:12352592-12352614 CCCCTGTGTACTCATCAGAATGG - Intronic
1187395529 X:18915985-18916007 CCAGTGTGTATCCAACACAATGG + Intronic
1187470958 X:19569458-19569480 ACCCTGTGTACCCAGCAGGAGGG - Intronic
1187539922 X:20182964-20182986 TCACTGCATACTCACCAGAATGG - Intronic
1187559417 X:20387563-20387585 CCACTTTATACCCACTAGGATGG + Intergenic
1187908420 X:24088320-24088342 CCACTATATACCCACTAAAATGG - Intergenic
1187911280 X:24113550-24113572 CCACTTTGTACCCAGTAGGATGG - Intergenic
1188378364 X:29461232-29461254 CCACATTGCACCCACTAGAATGG + Intronic
1188969344 X:36594471-36594493 CCACTACATATCCACCAGAATGG - Intergenic
1189055276 X:37693049-37693071 CCACTTTGAGCTCACCAGAAAGG + Intronic
1189375341 X:40462105-40462127 CCACTGTGATCCCACCAGTGTGG + Intergenic
1189764412 X:44355667-44355689 CCACTTTACACCCACTAGAATGG + Intergenic
1190155091 X:47984227-47984249 CCACTATACACCCACAAGAAAGG + Intronic
1190782011 X:53606413-53606435 ACACTTCCTACCCACCAGAATGG + Intronic
1192381441 X:70620404-70620426 CCACTGCATACCTATCAGAATGG + Intronic
1193422578 X:81300466-81300488 CCACTTTATAGCCATCAGAATGG - Intergenic
1193723118 X:85010215-85010237 CCACTGTATACCTACTAGCAGGG - Intronic
1194903812 X:99548227-99548249 CCACTTTGTACCTACTAGTATGG + Intergenic
1195168230 X:102240935-102240957 CTACTATGTACCCACAAAAATGG - Intergenic
1195190627 X:102446152-102446174 CTACTATGTACCCACAAAAATGG + Intronic
1195305491 X:103578530-103578552 CCACTTTATACCCACTAGGATGG - Intronic
1195598043 X:106715237-106715259 TCACTGCATACCTACCAGAATGG - Intronic
1195829450 X:109039962-109039984 CCATTGTGTACACACAAGTAGGG + Intergenic
1196002338 X:110799094-110799116 TCACTATATACCTACCAGAATGG - Intergenic
1196100988 X:111846968-111846990 TCACTGTGGATCCACCCGAAGGG - Intronic
1196317525 X:114246239-114246261 CCGCTTTGCATCCACCAGAATGG + Intergenic
1196568163 X:117232347-117232369 CCACTTCATACCCACTAGAATGG + Intergenic
1196823127 X:119719446-119719468 CCACTTTATACCCACTAGAATGG + Intergenic
1197619266 X:128728940-128728962 CCACTACACACCCACCAGAATGG - Intergenic
1198413782 X:136398580-136398602 CTTCTCTGCACCCACCAGAATGG + Intronic
1199669316 X:150129247-150129269 CCACTTCATACCCACAAGAATGG - Intergenic
1200185141 X:154177503-154177525 CCACTATGTACCCAGTAGATTGG + Intergenic
1200190794 X:154214641-154214663 CCACTATGTACCCAGTAGATTGG + Intergenic
1200196545 X:154252443-154252465 CCACTATGTACCCAGTAGATTGG + Intergenic
1200202200 X:154289561-154289583 CCACTATGTACCCAGTAGATTGG + Intronic
1200218026 X:154377213-154377235 CCACTGTGTCCCCAGCAATATGG - Intergenic
1200325366 X:155232635-155232657 TCACTGTGTACCCACCGGAATGG + Intronic
1201153248 Y:11106848-11106870 CCACTCTGCACCCACAAGTAAGG - Intergenic