ID: 999692288

View in Genome Browser
Species Human (GRCh38)
Location 5:154158526-154158548
Sequence CTGCATGTGTAGGGAGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 289}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999692288_999692293 24 Left 999692288 5:154158526-154158548 CCCTGCTCTCCCTACACATGCAG 0: 1
1: 0
2: 1
3: 32
4: 289
Right 999692293 5:154158573-154158595 TGCAATCATCCACACATAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999692288 Original CRISPR CTGCATGTGTAGGGAGAGCA GGG (reversed) Intronic
902043487 1:13509172-13509194 ATGGAGGTGTAGGGAGGGCAAGG - Intronic
903323599 1:22556671-22556693 CTGCAAGTGCAGGGAGAGAGGGG - Intergenic
904448841 1:30598028-30598050 CTGCATCTATAAGGAGAGCCAGG + Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905182923 1:36177892-36177914 CAGGATGTGGAGGGAGAGGATGG - Exonic
905226883 1:36484755-36484777 CTGCATGACTAGGGAGAGGAGGG - Intergenic
905935147 1:41817499-41817521 CTGCATGGCTAGGCTGAGCAGGG + Intronic
906519896 1:46460809-46460831 CTGCATGGGTAATGAGACCAGGG - Intergenic
907489504 1:54800185-54800207 CTCCATGTGAAGGGAGCACAGGG - Intronic
910755849 1:90689546-90689568 CTACAAGAGTAAGGAGAGCATGG + Intergenic
911360624 1:96872041-96872063 CTACATGTGTAGCAAGATCAGGG + Intergenic
911438745 1:97898353-97898375 CTGAAAGTCTAGGGAGACCAAGG - Intronic
912489726 1:110055465-110055487 CAGCATGGTTAGGGACAGCAGGG + Intronic
912649264 1:111423703-111423725 GTGAATCTGTAGGGAGACCAGGG + Exonic
912814956 1:112821598-112821620 CTTCATGTGTAGGGAAGGGAGGG + Intergenic
913438314 1:118870625-118870647 CTACATGTGGAGGGTGAGGATGG - Intergenic
915489416 1:156242963-156242985 CCCCATGTGTAGGGAGAGGAGGG + Intronic
915705223 1:157837293-157837315 ATGGCTGTGTAGGGAGACCAGGG + Intronic
917334329 1:173912763-173912785 CGCCATGTGTTGGGAAAGCAGGG - Intronic
921883723 1:220282095-220282117 CTGCATCTGTAGGGTGAGTATGG + Intergenic
923133639 1:231098641-231098663 CTACATGTGTAGGGATTGGAGGG - Intergenic
923391048 1:233515039-233515061 CTGCGGCTGCAGGGAGAGCATGG + Intergenic
924356068 1:243177532-243177554 CTTCTTGGGTAAGGAGAGCAGGG + Intronic
1064008642 10:11717518-11717540 CTGCAGGGGTGGGGTGAGCAGGG + Intergenic
1064886710 10:20120712-20120734 CTTCATGTGTAGGGAAGGGAGGG + Intronic
1065735202 10:28745205-28745227 CTGAATGTGTTGGAAGAGCAAGG + Intergenic
1066091493 10:32025664-32025686 ATTCATGTGTAGGCTGAGCATGG - Intronic
1067033888 10:42898882-42898904 CTGTATTTGTAGGGAGTGAAAGG + Intergenic
1067337821 10:45378973-45378995 CTGCAGGTGTAGGTAGGGCAGGG + Intronic
1068775387 10:60863066-60863088 GTGCATGTGTAGGGTGATGATGG + Intergenic
1068777122 10:60879771-60879793 GTGCATGTGTATGGAGAGAGAGG - Intronic
1069394664 10:67975638-67975660 ATGCATGTGTCGGCTGAGCATGG - Intronic
1070646000 10:78203001-78203023 CTGCCCCTGTAGGGAGAGAAAGG - Intergenic
1071555366 10:86597428-86597450 CTGCACGTGGAAGGCGAGCAGGG - Intergenic
1071897454 10:90082580-90082602 CTTCATGTGTAGGGAAGGGAGGG + Intergenic
1074248128 10:111714519-111714541 CTGCAGCTGTAGGGAGGGCATGG - Intergenic
1074703372 10:116111285-116111307 CTTCATGTGCAGTGAGGGCAAGG + Intronic
1076838442 10:133032819-133032841 CTGCAGGTGTGCAGAGAGCAGGG + Intergenic
1077470743 11:2759406-2759428 CTGCATGTGTGCAGAGGGCAGGG + Intronic
1078180732 11:9007973-9007995 ATGCATGGGTAGGGAGGGAATGG - Intergenic
1080896014 11:36449284-36449306 GTGCATGTCTAGGGAGAGAATGG - Intronic
1081673376 11:44954289-44954311 CTGCTTGTGGAGGGCGACCAGGG - Intergenic
1081699529 11:45144392-45144414 CTGCATCTGTAGGGTGAGACTGG - Intronic
1083052966 11:59793263-59793285 CTGCAGGTGCAGGGAGTTCAGGG + Intronic
1085040962 11:73326083-73326105 CTGTATGTGCAGGGTTAGCATGG + Intronic
1085321017 11:75574045-75574067 CTGCTTGTGTAGGGTGGTCAGGG - Intergenic
1085525659 11:77162038-77162060 CTGCAGGTGGAGGCAGAGCCAGG + Intronic
1086738882 11:90341929-90341951 CTGTGTGTGTTGGGAGTGCAGGG - Intergenic
1088993346 11:114973572-114973594 CTGCATGAGTGGGGAAAGGAAGG - Intergenic
1090535644 11:127638340-127638362 GTGCCGGTGTGGGGAGAGCATGG - Intergenic
1091348877 11:134876861-134876883 GGGCATGTGGAGGGACAGCAAGG - Intergenic
1091988342 12:4932721-4932743 CTCCATCTGCTGGGAGAGCATGG - Intergenic
1092549139 12:9478793-9478815 CTGCAAGTTTATGAAGAGCAGGG + Intergenic
1092592464 12:9964617-9964639 CTTGATGTGTAGGGAAAGGAGGG + Intronic
1093211121 12:16310210-16310232 TTGCATGAGAAGGCAGAGCATGG + Intergenic
1094315730 12:29136318-29136340 CTTGATGTGTAGGGAAAGGAAGG + Intergenic
1094503857 12:31043674-31043696 CTGCAAGTTTATGAAGAGCAGGG - Intergenic
1098629707 12:72710231-72710253 CTTTATGTGTAGGGAAGGCAGGG + Intergenic
1098690997 12:73488101-73488123 CTGTATGTGGAGGGAGAGTTAGG - Intergenic
1098855962 12:75653527-75653549 ATGAATGTGTAGGGAGAACATGG - Intergenic
1099444266 12:82733477-82733499 GTGCATGTGTAGGGAGGGTGGGG + Intronic
1100335267 12:93623277-93623299 CTGCAGGTGAAGGGGAAGCAAGG - Intergenic
1101251423 12:102939650-102939672 CTGCATGGTTAAGAAGAGCAGGG - Intronic
1102380864 12:112465634-112465656 AAGCAGGTGTATGGAGAGCAAGG - Intronic
1102426476 12:112848023-112848045 TTGCATGAGTTGGGAGAGCTAGG + Intronic
1103205198 12:119123524-119123546 CTGCCTGCGTAAGGGGAGCAAGG + Intronic
1103821463 12:123702238-123702260 CAGCATCTGCAGGGAGAGCTGGG - Intronic
1107062075 13:36170346-36170368 CAGCATGAGGAGCGAGAGCATGG + Intronic
1108088952 13:46825429-46825451 CTGCCCATGTAGGGAGAACATGG + Intergenic
1108850999 13:54728800-54728822 CAGAATGTGGAGGAAGAGCAAGG - Intergenic
1111621608 13:90732021-90732043 CTGCAGGAGTAGGGAGCTCATGG + Intergenic
1115085269 14:29507838-29507860 ATGCAAGAGAAGGGAGAGCAGGG + Intergenic
1116034060 14:39606978-39607000 CTGCATGGGGAAGGTGAGCAAGG - Intergenic
1116203281 14:41826302-41826324 CTTCATGTGTAAGGAAAGTATGG - Intronic
1117746854 14:58878590-58878612 CTGCATGTCTAAGGCCAGCATGG - Intergenic
1118490678 14:66256329-66256351 CTGGATGTGTAAGGTGAGGAAGG + Intergenic
1118590198 14:67395341-67395363 CTGCCTGTGTTGGGTGGGCAGGG - Intronic
1118745120 14:68767872-68767894 TTGTCTGTGTAGAGAGAGCAGGG + Intergenic
1118936920 14:70296965-70296987 CTGGATGTGTAGGGAAGGGAGGG + Intergenic
1119572961 14:75692674-75692696 CTGCCTGTGTATGGGGAGCGAGG + Intronic
1122090475 14:99335238-99335260 CTGCATGGGAAGGAAAAGCAGGG + Intergenic
1122505891 14:102231533-102231555 CTCCATGTGTTGGGACATCAGGG - Intronic
1202854589 14_GL000225v1_random:42750-42772 CGGCATGTGCAGAGAGAGGACGG - Intergenic
1123760295 15:23426653-23426675 CCCCATGTGCAGTGAGAGCAAGG - Intergenic
1126773798 15:52082538-52082560 CAGGTTGTGTTGGGAGAGCAGGG + Intergenic
1126954252 15:53914583-53914605 CTGCAGGTGTCGGGGCAGCAGGG + Intergenic
1128109062 15:65065104-65065126 CTGCATGTCTGGGGACAGAAGGG - Intronic
1128455876 15:67831076-67831098 ATGTATGTGTGGGTAGAGCATGG + Intronic
1128838687 15:70832151-70832173 CTGCATCTTCCGGGAGAGCAGGG + Exonic
1128861700 15:71079660-71079682 CTGGATGTGTAGGGCAGGCATGG - Intergenic
1130773076 15:86944428-86944450 CAGCATGTGCAGGGAAAGCATGG + Intronic
1137731322 16:50692899-50692921 GTGTATGTGTTGGGAAAGCAGGG + Intergenic
1138401835 16:56751963-56751985 ATGCATATGCAGGGAGAGAAAGG - Intronic
1138833492 16:60404604-60404626 TTGCTTGTGTGGGGAGAGTAGGG + Intergenic
1139510932 16:67428283-67428305 CTGGCCGTGTAGGGAGAGCACGG - Intergenic
1140085469 16:71792248-71792270 CTGCCTGTGTTTGGAGGGCACGG - Intronic
1140799732 16:78475270-78475292 CTCCCTGTGTATTGAGAGCAGGG + Intronic
1141234040 16:82198998-82199020 CTGTGTGTGTGGGGAGAGGAGGG - Intergenic
1141339783 16:83192495-83192517 GAGCATGTGGAGGGAGAGCTGGG - Intronic
1142697322 17:1640619-1640641 CTGCCTGTGTCTGGAGAGCACGG + Exonic
1143480778 17:7226310-7226332 CTGCCTGTGGAGGGAGGGGAGGG + Exonic
1143631988 17:8144848-8144870 CTGTGTGTGCAGGGACAGCACGG + Exonic
1146357013 17:32142762-32142784 CTGCAGGGGCAGGGAGGGCAGGG - Intronic
1147335624 17:39725494-39725516 CAGCATGTGAAGGGAGGGAAGGG + Intronic
1148148254 17:45379564-45379586 CTGCATATTTGGGGAGAGCAAGG + Intergenic
1149619592 17:58033465-58033487 CAGCATGTGTAGAGATTGCATGG + Intergenic
1150645878 17:66977167-66977189 CTGGCTGTGTGTGGAGAGCAGGG - Intronic
1152386811 17:79979742-79979764 GTGGATGTGAAGGGAGACCAGGG - Intronic
1152464330 17:80457305-80457327 CTCCTCGTGTTGGGAGAGCATGG + Intergenic
1152508982 17:80772457-80772479 AGGCATGTGGAGGGAGAGGAAGG - Intronic
1152508992 17:80772486-80772508 GGGCATGTGGAGGGAGAGGAAGG - Intronic
1152552755 17:81038067-81038089 CTGCAGGTGTTGGGAGGGCAAGG + Intronic
1154396526 18:13995683-13995705 CTGAATCTGGAGGGAGAGCAGGG + Intergenic
1155768782 18:29671771-29671793 CTGCAGGTGCAGGGACTGCAAGG - Intergenic
1156585444 18:38426347-38426369 CTGCATGTGTTGGGGGAAGATGG + Intergenic
1156916190 18:42466340-42466362 CTTGATGTGTAGGGAAAGGAGGG - Intergenic
1156938814 18:42740815-42740837 CTTGATGTGTAGGGAAGGCAGGG - Intergenic
1157906104 18:51571581-51571603 CTTGATGTGTAGGGAAAGGAGGG + Intergenic
1158409612 18:57193770-57193792 CTTCATGTAGAGGGAGGGCAGGG - Intergenic
1159852926 18:73547756-73547778 CTGAAGGTGAAGGGAAAGCAAGG - Intergenic
1160767549 19:815140-815162 CTGCATGTGGAGGTAGCTCAGGG + Intronic
1161088775 19:2348014-2348036 CTGTGTGTGGAGGGAGAGAACGG - Intronic
1161088800 19:2348376-2348398 CTGTGTGTGGAGGGAGAGAACGG - Intronic
1161591246 19:5130072-5130094 GTGCCTGTGAAGGGAGAGGAAGG - Intronic
1161592978 19:5137051-5137073 CTGCATGTGGAGCGAGAGAAAGG - Intronic
1162904261 19:13814337-13814359 ATGCATGTGTAGGCTGGGCATGG - Intronic
1163082334 19:14953063-14953085 CTGCAGGGGGAGGGAGAACATGG + Intronic
1163105792 19:15122499-15122521 CTGGGTGGGTAGGGAAAGCAAGG - Intronic
1163822990 19:19506866-19506888 CTGCATGGGTAGGAAAACCAGGG - Exonic
1164627380 19:29738427-29738449 CAGCACCTGTAGGGAGGGCAGGG - Intergenic
1164760114 19:30722321-30722343 CTGCATGTGGAGGGAAGGCCTGG + Intergenic
1165164629 19:33843164-33843186 CTGTATGTGTGTGGTGAGCAGGG - Intergenic
1165510036 19:36261036-36261058 CTTGATGTGTAGGGAAAGGAGGG + Intergenic
1167608005 19:50492136-50492158 CTGAAGGTGCAGGGAGAGGAAGG + Intergenic
926484433 2:13437539-13437561 CAGGATGTGAAGGCAGAGCAAGG + Intergenic
927869280 2:26613477-26613499 CTGCCTGTGGAGGGAGGGCATGG - Intronic
927964383 2:27260153-27260175 CTTCATGTCTAGGGAGGGCGGGG - Intronic
929424872 2:41834110-41834132 CTGCAAGTCTCTGGAGAGCAGGG - Intergenic
931235206 2:60406956-60406978 CTGCATCTGCTGGGAGAGGAAGG - Intergenic
932465811 2:71923401-71923423 CTTGCTGTGTTGGGAGAGCATGG + Intergenic
933013378 2:77092543-77092565 CTTGATGTGTAGGGAAAGGAGGG - Intronic
934795051 2:97093122-97093144 CTGCCTTTGTTGGAAGAGCAAGG - Intronic
934885544 2:98021274-98021296 CTTCAAGTGAAGGGAAAGCAAGG - Intergenic
935470094 2:103448891-103448913 CTTCTTGTGGAAGGAGAGCATGG - Intergenic
935644525 2:105323215-105323237 CTGGATGAGGAGGGAGAGCCTGG + Intronic
936065290 2:109326871-109326893 CAGCAGGTGAGGGGAGAGCAGGG + Intronic
936557355 2:113508300-113508322 CTGGAGGTGGGGGGAGAGCAGGG + Intergenic
936741585 2:115518002-115518024 CTGCATGTGCAGAGATAACATGG + Intronic
937268605 2:120633025-120633047 CCGCAGGGGTAGGGAGAGCGGGG + Intergenic
937593586 2:123645395-123645417 CAGAATGTGAAGGGAAAGCAAGG - Intergenic
940004558 2:148998944-148998966 GTGTATGTGTAGGGGGAGAAGGG - Intronic
941952116 2:171166239-171166261 CTGAAAGCCTAGGGAGAGCAAGG + Intronic
943450459 2:188037597-188037619 CTTCATGTGTAGGGAAGGGAGGG - Intergenic
943792420 2:191948440-191948462 CTTCATGGGTTGGGTGAGCATGG + Intergenic
944621096 2:201516860-201516882 CTAGGTGCGTAGGGAGAGCAAGG + Intronic
946142543 2:217703973-217703995 CTGCAGGTGGAGGCAGAACATGG - Exonic
946196572 2:218035770-218035792 CTGCGTGTGTGGGGGGAGCAGGG - Intronic
946200854 2:218069936-218069958 CTGCGTGTGTGTGGGGAGCAGGG - Intronic
946201210 2:218071849-218071871 CTGCCTGTGTGTGGGGAGCAGGG - Intronic
947613120 2:231536122-231536144 CTGCATGGGTGGGGTGAGCATGG + Intergenic
1168779924 20:480270-480292 GTGTGTGTGTAGGGAGAGAAAGG + Intronic
1170042762 20:12055258-12055280 CTCCATGTCTAGGGAGTGTACGG + Intergenic
1170592926 20:17784798-17784820 CTGGATGTATAGGGAGGCCAAGG + Intergenic
1172093752 20:32450770-32450792 CCCCATGTGTAGGGGGGGCAGGG + Intronic
1173625886 20:44472687-44472709 CGGCATGTGCAGGTCGAGCACGG - Intergenic
1173652459 20:44675469-44675491 CTGGATGTGTAGGGAAGGGAGGG - Intergenic
1173888377 20:46481577-46481599 TTGCATGTGTTGGCAGCGCAGGG + Intergenic
1175131183 20:56790863-56790885 CTACATGTGCAGGAAGTGCAAGG + Intergenic
1175852167 20:62099449-62099471 CTGCGGGTCTAGGGAGAGCGGGG - Intergenic
1176144074 20:63557764-63557786 CTGCCTGTGTGGGGAGGGGAGGG - Intergenic
1176373510 21:6076238-6076260 CCGCACGTGTAGGGAGACCCCGG + Intergenic
1177171421 21:17660115-17660137 CTACAAGTGTAGAAAGAGCATGG - Intergenic
1177845036 21:26279176-26279198 TTGGAGGTGCAGGGAGAGCAAGG + Intergenic
1178093279 21:29187113-29187135 TTCCATGTGCAGGGAGAGCATGG + Intergenic
1178904343 21:36624105-36624127 CTCCATGTGTAGGGGGTGAAGGG + Intergenic
1179330037 21:40391007-40391029 TTGCAAGTGTAGGGAGTGGAGGG + Intronic
1179650042 21:42802373-42802395 CTTGATGTGTAGGGAAAGGAGGG + Intergenic
1179749967 21:43462005-43462027 CCGCACGTGTAGGGAGACCCCGG - Intergenic
1180158718 21:45989740-45989762 CTGGGTGTGTAGGGAGAAAAAGG + Exonic
1181055892 22:20260350-20260372 CTGGATGTCCAGGGAGAGCCAGG + Intronic
1181126872 22:20707952-20707974 CTGCATGTGGCGGCAGGGCAGGG + Exonic
1181277019 22:21693780-21693802 CTGGATGGTTAGGGAGAGCATGG - Intronic
1182432895 22:30311006-30311028 GTGGATGTGCAGGGGGAGCATGG + Intronic
1184092362 22:42299381-42299403 GTCCATGGGGAGGGAGAGCAAGG - Intronic
1184704512 22:46201446-46201468 GTGAAGGTGTAGGGAGATCATGG + Intronic
1203276299 22_KI270734v1_random:89320-89342 CTGGATGGGGAGGGAGAGGAGGG + Intergenic
949205288 3:1430865-1430887 ATGTATGTGTAGGGAGGGCATGG + Intergenic
950183654 3:10932123-10932145 CTGCAGATATAGGGAGAGCGGGG - Intronic
951137793 3:19124093-19124115 GTGCATCTGAAGAGAGAGCAAGG + Intergenic
951717597 3:25665124-25665146 TTCCATTTGAAGGGAGAGCAGGG + Intergenic
952184833 3:30957342-30957364 CTGCATGTCCAGGGAGGTCAGGG - Intergenic
955238818 3:57162874-57162896 CTGCATGAGAAGGTAAAGCAAGG + Intronic
956231220 3:67018758-67018780 CTGCATGTGAAGGGAAAACTTGG + Intergenic
956465763 3:69519283-69519305 GTGCATGGCTGGGGAGAGCAGGG + Intronic
958179206 3:90035953-90035975 TTCCATCTATAGGGAGAGCAAGG + Intergenic
959988435 3:112603143-112603165 CAGCATGTCTATGGACAGCATGG + Intergenic
960631729 3:119738993-119739015 TTTCATTTGTAGGGATAGCATGG + Intronic
960677452 3:120210018-120210040 CCGGATGTGTAGGGAGACAAAGG + Intronic
961711338 3:128830743-128830765 CTTGATGTGTAGGGAAAGGAGGG + Intergenic
961881336 3:130063433-130063455 CTTGATGTGTAGGGAAAGGAGGG - Intergenic
962045191 3:131751807-131751829 CTGCTTTTGTAGGGAAAGCAGGG + Intronic
962388597 3:134953205-134953227 CTGCAGGTGTCTGGGGAGCAAGG - Intronic
964555817 3:157936723-157936745 CTACATGTATAGTGAGGGCAAGG + Intergenic
965494492 3:169381404-169381426 CTGGATGTGGCAGGAGAGCATGG + Intronic
965626033 3:170684876-170684898 CTTGATGTGTAGGGAAGGCAGGG + Intronic
967211874 3:187177071-187177093 CTTGATGTGTAGGGAAGGCAGGG + Intronic
967283254 3:187843025-187843047 GTGCAGGTGTAGGCAGAGCCTGG + Intergenic
967337124 3:188357018-188357040 TTGCATGTGTATGGAGAAGAAGG - Intronic
967425099 3:189317854-189317876 CTGCATGTGTTCAGAGAGGAGGG + Intronic
969201914 4:5613334-5613356 CTGCTTGTGAAGGGAAAGCTGGG - Intronic
969653739 4:8483955-8483977 CTTCATGTGTAGGGAAGGGAGGG + Intronic
971888878 4:32491627-32491649 ATGCATTTGTAGAGAGAGTATGG + Intergenic
973822651 4:54676583-54676605 CTGCATGGGTGGAGGGAGCAGGG + Intronic
975991149 4:80261631-80261653 ATGCATGTGTAAGGAGTACAGGG + Intergenic
976140299 4:81984584-81984606 CTGCATGTGGAGGAGGAACAAGG + Intronic
976558888 4:86478960-86478982 CTTCATGTGTAGGGAAGGGAGGG - Intronic
976697879 4:87937478-87937500 CTTGATGTGTAGGGAAAGGAGGG + Intergenic
978194350 4:105953578-105953600 CTGCATCTGTAGAGAGAATAGGG + Intronic
979234871 4:118388263-118388285 CAGAAGGTGTAGGGAAAGCAAGG + Intergenic
979245742 4:118502097-118502119 CTTCTTGGGTAAGGAGAGCAGGG - Intergenic
982319217 4:154061373-154061395 CTTGATGTGTAGGGAAAGGAGGG - Intergenic
984550503 4:181153633-181153655 CTGCATGTGGAGGTATGGCACGG - Intergenic
986389160 5:7267751-7267773 CTTGATGTGTAGGGAAGGCAGGG - Intergenic
986554731 5:8999877-8999899 CTTGATGTGTAGGGAAGGCAGGG + Intergenic
987282282 5:16423885-16423907 CTTGATGTGTAGGGAAAGGAGGG - Intergenic
987658188 5:20836206-20836228 TTGCATGTGTGTGGAGAACATGG - Intergenic
987905817 5:24075698-24075720 CTGCATGTGCAGAGAGAGAATGG + Intronic
988801538 5:34700474-34700496 CTGGAACTGCAGGGAGAGCAAGG - Intronic
989430824 5:41353389-41353411 CTGAGTGTGTAGGCAGGGCACGG - Intronic
991437841 5:66614761-66614783 ATGCAGGTTTGGGGAGAGCAGGG + Intronic
992517697 5:77512119-77512141 TTACTTGTGTATGGAGAGCAAGG + Intronic
995449166 5:112281388-112281410 CTCCATCTGTGGGAAGAGCAGGG + Intronic
997875554 5:137543651-137543673 CTGTGTGTGTAAGGAGAGGAGGG + Intronic
998714597 5:144868522-144868544 CTGCATCTGCAGGGAGAACCAGG - Intergenic
999692288 5:154158526-154158548 CTGCATGTGTAGGGAGAGCAGGG - Intronic
1000325874 5:160171618-160171640 CTGCATGTGTAAGGGGAATAAGG - Intergenic
1001013234 5:168117440-168117462 ATGCATGTGTAGGGAAAACATGG - Intronic
1001042383 5:168346115-168346137 CTTCAGGTGGAGGGAGAGCCAGG - Intronic
1001410722 5:171509452-171509474 GAGCTTGTGTAGGGGGAGCAGGG - Intergenic
1001907079 5:175481648-175481670 CTGCATGGGAGGGGAGAACATGG + Intronic
1002619136 5:180474653-180474675 CTGCGTGTGGAGTGAGAGCTGGG - Intergenic
1003079269 6:3007889-3007911 CTGCAAATGTAGGGTTAGCATGG + Intronic
1003466029 6:6380874-6380896 ATGCATGTGAAGAGAGAGAAGGG + Intergenic
1003614296 6:7641398-7641420 CAGCAGGAGTAGGGAGAGCCGGG + Intergenic
1005222426 6:23601879-23601901 CTGCATGTGCAGGGATCACATGG + Intergenic
1006220282 6:32484170-32484192 CTGCAGTTGTGGGGAGGGCATGG + Intergenic
1006325182 6:33348373-33348395 CTTGATGTGTAGGGAGGGGAGGG - Intergenic
1006740816 6:36307148-36307170 CTGCAGGTATTGAGAGAGCAGGG + Intronic
1006974468 6:38085728-38085750 CTGCATGTATGGGCTGAGCACGG - Intronic
1008476915 6:51942880-51942902 CTTGATGTGTAGGGAGGGGAGGG - Intronic
1009270149 6:61604675-61604697 CTTGATGTGTAGGGAAAGGAGGG - Intergenic
1011231911 6:85171251-85171273 CTGCATGTGTAGAGAGGTAAGGG - Intergenic
1011495553 6:87933710-87933732 AGGCATGGGTAGGGAGAGCCAGG - Intergenic
1011518708 6:88180870-88180892 CAGCATGATTAGGGAGAGCTTGG + Intergenic
1012964609 6:105660182-105660204 CAGCAGGTGAAGGGAAAGCAAGG + Intergenic
1013826858 6:114222656-114222678 CTGCTCGTGAAGGAAGAGCAAGG + Intronic
1014100296 6:117504379-117504401 TTGCATCTGTGGGGAGAGGAAGG + Intronic
1014520711 6:122439094-122439116 CTGCAGGTGTGGAGAGTGCAAGG + Intergenic
1015456630 6:133433848-133433870 CTGCATGTGTAGTGAGCGACTGG + Intronic
1015608131 6:134983053-134983075 ATGCATGAGTAGGGAGAAAAAGG + Intronic
1016113861 6:140258996-140259018 CTTGATGTGTAGGGAAGGCAGGG + Intergenic
1017122366 6:151036683-151036705 GTGCATGTTTGGGGAAAGCATGG - Intronic
1017547816 6:155470266-155470288 ATGCATGTGAAGACAGAGCATGG - Intergenic
1018123824 6:160662644-160662666 CTGTGTGTGTAGGGAGTGCAGGG - Intronic
1018272372 6:162094109-162094131 CTGACTGAGTAGGTAGAGCAAGG + Intronic
1018349070 6:162937366-162937388 GTGCAGGTGTAGAGAGAGAAGGG + Intronic
1018573398 6:165233709-165233731 GGGCATCTGCAGGGAGAGCAAGG + Intergenic
1018618443 6:165709100-165709122 CGGAAAGTGTGGGGAGAGCACGG - Intronic
1018634752 6:165851011-165851033 CTGCGTGTATAGGAAGAGAAAGG + Intronic
1020278515 7:6638153-6638175 CTGCTTGTGTGGGGAGACCTCGG + Intronic
1023669580 7:42561568-42561590 CTGGAGATGTAGGGAGAGTAGGG + Intergenic
1024738871 7:52334475-52334497 CTTCATGTGTAGGGAAAGGAGGG + Intergenic
1026669120 7:72371852-72371874 CTGCATTCATGGGGAGAGCAAGG - Intronic
1027812105 7:82916288-82916310 GTGCTTGGGTAGGAAGAGCAGGG + Exonic
1028589483 7:92480394-92480416 CTTGATGTGTAGGGAGGGGAGGG + Intergenic
1028737867 7:94237906-94237928 CTGCATGTCTAGGTAGAAAATGG + Intergenic
1029425856 7:100493738-100493760 CTGCGTGTGCAAGGAGATCAAGG + Exonic
1030310132 7:108060410-108060432 CTGCAGGTGTGGGGAGTGGAGGG + Intronic
1030441373 7:109593372-109593394 CTTGATGTGTAGGGAAAGGAGGG + Intergenic
1032281736 7:130508682-130508704 CTGCATCAGTGGGGAGTGCAAGG + Intronic
1032716450 7:134512936-134512958 CAGCATGTGTAGGTAGGGAAGGG + Intergenic
1034558542 7:151865097-151865119 CTGCCTGTGGATGGAAAGCAAGG - Intronic
1034724410 7:153321980-153322002 CTGGATGTGAGGAGAGAGCATGG - Intergenic
1034902092 7:154914199-154914221 CTGCAGGTGTAGGGAGAGCCGGG + Intergenic
1035020516 7:155797515-155797537 CTGCAATTCTGGGGAGAGCATGG + Intergenic
1035434852 7:158852048-158852070 GTGCCTGTGTAGGGTTAGCAGGG - Intergenic
1035636250 8:1146681-1146703 GTGCCTGTGTAGGGAGAGGGGGG + Intergenic
1035674280 8:1444065-1444087 AGGGAGGTGTAGGGAGAGCATGG - Intergenic
1037192321 8:16141609-16141631 CTGCATGAGGAGGGAGGGCATGG + Intronic
1037819611 8:22129349-22129371 CTGCATGTGGAGAGGCAGCATGG - Intronic
1041271015 8:56109166-56109188 CTGCATGTTTGGTGATAGCAGGG - Intergenic
1044543124 8:93429968-93429990 CTGCGTGTGGCTGGAGAGCAGGG - Intergenic
1045429992 8:102104778-102104800 ATGCATGTGTGGGGAGTGGAAGG + Intronic
1045753984 8:105520399-105520421 CGGGATGTGAAGGCAGAGCATGG + Intronic
1046784316 8:118250132-118250154 CTGCGTGGGTAGGCAGAGCCAGG + Intronic
1048293583 8:133198454-133198476 AGGCTTGTGTAGGAAGAGCAGGG - Intronic
1048711807 8:137220699-137220721 ATGCATTTGTATGGAGAGAATGG + Intergenic
1049253302 8:141600828-141600850 CTGCATGTGTAGAGGGTGCCTGG - Intergenic
1049895648 9:108999-109021 CTGGAGGTGGGGGGAGAGCAGGG - Intergenic
1051086002 9:13349748-13349770 CTGCATGTGTGGGGGGGACAGGG - Intergenic
1051427708 9:16950439-16950461 CAGCATGCCTGGGGAGAGCATGG + Intergenic
1055810339 9:80141581-80141603 CTTCATGTGTAGGGAAGGGAGGG - Intergenic
1056705263 9:88946858-88946880 CTGCATGTGTTGGGAGTGCCTGG - Intergenic
1056927524 9:90847547-90847569 CTGCAGGTGTGGAGGGAGCACGG - Intronic
1060020828 9:120129726-120129748 CTGCAGGTTTTGAGAGAGCAGGG - Intergenic
1060318144 9:122531997-122532019 CTTGATGTGTAGGGAAGGCAGGG + Intergenic
1060318164 9:122532090-122532112 CTTGATGTGTAGGGAAGGCAGGG + Intergenic
1061217157 9:129228154-129228176 CTACATGTGAAGGGTGTGCAGGG + Intergenic
1062250568 9:135591800-135591822 CTGCCTGGGGAGGGAGGGCAGGG - Intergenic
1062459466 9:136656879-136656901 CTGCCCGTGTGGGGAGAGCTGGG - Intergenic
1062479015 9:136742959-136742981 CAGCCTGTGTCGGGAGAGGAGGG + Exonic
1062697231 9:137881612-137881634 CTGCATGTGCAGGGTTGGCATGG - Intronic
1185713026 X:2319245-2319267 CTGCAGGAGTAGGGAGAGGAGGG - Intronic
1186457997 X:9725754-9725776 CTCCATGGGTTGGGAGAGCAGGG + Exonic
1195844991 X:109217142-109217164 CTGCAGGTATAGGGAGAGGTTGG + Intergenic
1196331112 X:114470929-114470951 CTTGATGTGTAGGGAAGGCAGGG - Intergenic
1196341432 X:114602839-114602861 CTTGATGTGTAGGGAAGGCAGGG + Intronic
1196533267 X:116814033-116814055 CTTGATGTGTAGGGAAGGCAGGG + Intergenic
1197155920 X:123270200-123270222 CTGCAGGTGAAGGGAGAGCTTGG - Intronic
1197405732 X:126046796-126046818 CTGTATGTGTAGGCAGAGGTGGG + Intergenic
1197649726 X:129051620-129051642 CTGCATGGCTGGGGAGAGCTCGG + Intergenic
1197933379 X:131716234-131716256 CTTGATGTGTAGGGAAGGCAGGG - Intergenic
1200283663 X:154800453-154800475 TTGCATGTGTACTGAGAGCATGG - Intronic