ID: 999693490

View in Genome Browser
Species Human (GRCh38)
Location 5:154168573-154168595
Sequence CTCTGCAAACAGCTGAATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 254}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999693486_999693490 4 Left 999693486 5:154168546-154168568 CCTGCACATCCCAGCTTTGTCCA 0: 1
1: 0
2: 0
3: 31
4: 274
Right 999693490 5:154168573-154168595 CTCTGCAAACAGCTGAATCTTGG 0: 1
1: 0
2: 0
3: 28
4: 254
999693488_999693490 -6 Left 999693488 5:154168556-154168578 CCAGCTTTGTCCACATGCTCTGC 0: 1
1: 0
2: 4
3: 37
4: 263
Right 999693490 5:154168573-154168595 CTCTGCAAACAGCTGAATCTTGG 0: 1
1: 0
2: 0
3: 28
4: 254
999693485_999693490 10 Left 999693485 5:154168540-154168562 CCGTAGCCTGCACATCCCAGCTT 0: 1
1: 0
2: 2
3: 29
4: 434
Right 999693490 5:154168573-154168595 CTCTGCAAACAGCTGAATCTTGG 0: 1
1: 0
2: 0
3: 28
4: 254
999693487_999693490 -5 Left 999693487 5:154168555-154168577 CCCAGCTTTGTCCACATGCTCTG 0: 1
1: 0
2: 2
3: 26
4: 210
Right 999693490 5:154168573-154168595 CTCTGCAAACAGCTGAATCTTGG 0: 1
1: 0
2: 0
3: 28
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999693490 Original CRISPR CTCTGCAAACAGCTGAATCT TGG Intronic
902563886 1:17297145-17297167 CTTTGCAATCAGCTAAATCTGGG + Intergenic
903102246 1:21040825-21040847 CTGTAAAAACAGCTGAGTCTTGG + Intronic
903692906 1:25186775-25186797 CTCTGCAAAATGCTCACTCTAGG + Intergenic
905286417 1:36883447-36883469 CACTGCAAACAGCTGCCCCTTGG + Intronic
906100986 1:43261457-43261479 CTCTGGACACATCTGAATATTGG + Intronic
906592567 1:47040350-47040372 CTTTGCAAACAGCATAACCTGGG - Intronic
906807374 1:48792310-48792332 CTCTGCAAACACCTTGATTTTGG + Intronic
907583289 1:55591516-55591538 CTCTGCCAACAGCTTGATCATGG - Intergenic
908375103 1:63529070-63529092 TTCTGTAAACAGCTGAATTAAGG + Intronic
908431260 1:64060735-64060757 CTCTGCAGAGTGCTGAGTCTAGG - Intronic
908580116 1:65506232-65506254 TTATGCAAACAACTGAATCCCGG - Intronic
909113610 1:71508260-71508282 CTATGCAAACAGTTGAATGCAGG + Intronic
909917682 1:81340341-81340363 CTCTTCAAAAAGCAGAAGCTTGG - Intronic
910967045 1:92818337-92818359 TACTGGAAACAGATGAATCTTGG + Intergenic
911866963 1:103039608-103039630 CTCTGTCAACACCTGGATCTTGG + Intronic
916214998 1:162386520-162386542 CTCAGCACACAGCTGTATCCTGG + Intronic
917798311 1:178548039-178548061 CTCTGCAAATAGCTGCACCTTGG - Intronic
919885935 1:201934899-201934921 CTCTGCCAACACCTAAATGTAGG + Intronic
920349915 1:205331157-205331179 ATCTGCAAAGAGCTCACTCTTGG + Intergenic
920537867 1:206751912-206751934 CCCTGCTAGCAGGTGAATCTAGG - Intergenic
920788142 1:209062487-209062509 CTCTTCTAAGAGCTGAAGCTGGG - Intergenic
922190173 1:223311909-223311931 ATCAGCAAACAGCTGAATCCTGG - Intronic
922215071 1:223513540-223513562 CTCTGCAAACAAGGGAATCCGGG + Intergenic
922891546 1:229065807-229065829 CTCTGCAAACAGATGCCACTCGG - Intergenic
923064207 1:230503331-230503353 CTCTGCCAACACCTTGATCTTGG + Intergenic
923213036 1:231823098-231823120 TTCTGCAAGTAGCTGCATCTGGG - Intronic
924805438 1:247357925-247357947 CCCTGCGAACAGCTGAATGGGGG + Intergenic
924907675 1:248473728-248473750 GTCTGCAAACAGCAGCATATCGG - Exonic
924916433 1:248574358-248574380 GTCTGCAAACAGCAGCATATCGG + Exonic
1063290738 10:4744304-4744326 CTCTGCCAACAGCTTGATTTTGG + Intergenic
1064314842 10:14245759-14245781 CCCTGCTAACACCTTAATCTCGG + Intronic
1067671912 10:48331546-48331568 CTGTGCAAACAGCTGAACAGGGG - Intronic
1068481208 10:57590976-57590998 CTCTGCAAGAAGCTGAAGGTGGG - Intergenic
1068850041 10:61727560-61727582 CTCTTCAAATAGCAGAAACTTGG + Intronic
1070761133 10:79025034-79025056 CTCGGCAGAGAGCTGGATCTGGG + Intergenic
1070790257 10:79184948-79184970 CCCTGCAAAGTGATGAATCTAGG + Intronic
1071059433 10:81552313-81552335 GTCTGCAAACAGATGCAACTTGG - Intergenic
1071237032 10:83661175-83661197 CTCTGCCAACACCTTGATCTTGG + Intergenic
1071379891 10:85048021-85048043 CTCTGTATAAAGCTGAAGCTAGG + Intergenic
1075544413 10:123343547-123343569 CTCTGGAAACAGATGGAGCTGGG + Intergenic
1076191905 10:128489148-128489170 CTCTGCAAACTGCAGAAGCCAGG + Intergenic
1076295555 10:129381076-129381098 CTCTGCCAACACCTGGACCTTGG + Intergenic
1076470533 10:130715141-130715163 CTCTGCAATCAGCTTCGTCTCGG + Intergenic
1081741413 11:45443580-45443602 CTCTCCCAACAGCTGGATTTTGG - Intergenic
1083207596 11:61161775-61161797 CTCTGTACACAGCTCGATCTTGG + Intergenic
1084206367 11:67596548-67596570 CCTTGCAAACATATGAATCTGGG - Intergenic
1085798506 11:79565704-79565726 CCCTGCCAACACCTGGATCTTGG + Intergenic
1085940333 11:81199975-81199997 CCATGCAAACAGCTGAAAGTGGG + Intergenic
1086368084 11:86128776-86128798 CTCTGTAAACAGCTCAAGCCAGG + Intergenic
1087327544 11:96742070-96742092 CACTGCACCCAGCTGAACCTAGG - Intergenic
1089052160 11:115555318-115555340 CTTTGCAATCAGATGAATATAGG - Intergenic
1089098204 11:115937497-115937519 CTCTGCCAACACCTTGATCTTGG + Intergenic
1092028469 12:5263097-5263119 CTCTGCTTACAGATGAATTTTGG - Intergenic
1092124639 12:6066553-6066575 CCCTCCAAACAGCGGAAGCTTGG + Intronic
1093486316 12:19656720-19656742 CACTGCCAACACCCGAATCTTGG - Intronic
1096188997 12:49602758-49602780 ATCAGCAAATAGCTGAACCTTGG - Intronic
1096794793 12:54069695-54069717 CTCTGCTAACACCTTGATCTTGG - Intergenic
1097236548 12:57544171-57544193 CTCAGCATACAGCTGTCTCTTGG + Intronic
1098525503 12:71482335-71482357 CCCTGCCAACACCTTAATCTTGG - Intronic
1099359494 12:81682322-81682344 ATCTGCAAACACCTTCATCTTGG + Intronic
1100775408 12:97968005-97968027 TTCTGCAAACAGCTGCCTCTTGG + Intergenic
1101064818 12:101009321-101009343 CTCTGCTGACAGCTTGATCTTGG + Intronic
1101539398 12:105651447-105651469 CTCTGCTAACAACTTAATTTTGG - Intergenic
1102175242 12:110869108-110869130 TTCTGCAAGCAGTTGCATCTGGG - Intronic
1102721434 12:115019842-115019864 CTCTGCAAACATATGAATATTGG + Intergenic
1103229041 12:119312473-119312495 CCCTGCCAACACCTTAATCTTGG + Intergenic
1104522117 12:129485620-129485642 CTCTGCAAACAGCTGCCACCTGG - Intronic
1104945823 12:132414510-132414532 CTCTGCAAGCCGCTGTTTCTGGG + Intergenic
1105207968 13:18238895-18238917 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1105356313 13:19663244-19663266 CCCTGCAAGCGGCTGACTCTAGG - Intronic
1105534001 13:21247211-21247233 CGTTGCAATCTGCTGAATCTGGG - Intergenic
1106543823 13:30713769-30713791 CTCTGAAAACTTCTGAATTTGGG + Intronic
1106597192 13:31155178-31155200 CTCTCCAAACAACTGCAACTGGG + Intronic
1107411745 13:40164364-40164386 ATCTGCCAACCCCTGAATCTAGG + Intergenic
1107861190 13:44662347-44662369 CCCTGCCAACACCTTAATCTTGG + Intergenic
1108701557 13:52948421-52948443 CTCTGCAAGCAGTTGTAACTTGG + Intergenic
1109238703 13:59856424-59856446 CTCTGCCAACACCTTGATCTTGG - Intronic
1109798124 13:67342760-67342782 CCGTGCAAACAGCTGAATAGGGG - Intergenic
1109814236 13:67558859-67558881 CTCAGCACACAGATGAATTTTGG - Intergenic
1110553892 13:76836885-76836907 CTCTGCAGACAGGTGTCTCTCGG - Intergenic
1112989030 13:105488068-105488090 CACTGTAAACAGCTGTATTTTGG + Intronic
1113679171 13:112230601-112230623 CTCTCCCAGCAACTGAATCTAGG - Intergenic
1116436748 14:44903269-44903291 CTCTTCACACAGTTCAATCTTGG - Exonic
1118562357 14:67099877-67099899 ATCTGCAAACAGCAGAGTTTTGG - Intronic
1118795838 14:69143031-69143053 AACTGCAAACATCAGAATCTAGG + Intronic
1122600176 14:102917470-102917492 CTCTCCACACAGCACAATCTAGG + Intergenic
1122936061 14:104956802-104956824 CTCTGCACACAGCTGTGTGTTGG - Intronic
1127427142 15:58867630-58867652 CTCTGCAAACACCTTGATTTTGG - Intronic
1128436590 15:67656681-67656703 CTCTGCCATCAGCTGACTCATGG + Intronic
1129057410 15:72830833-72830855 CTCTGCTGACAGCTTAATCTGGG - Intergenic
1129367771 15:75067367-75067389 CCCTGCAAACAGCTGAATGGAGG + Intronic
1130416674 15:83701073-83701095 CTCTGCAAACAGGAGAAGCAGGG - Intronic
1131640515 15:94287835-94287857 CACTGCTAACATCTGGATCTGGG - Intronic
1131946085 15:97623456-97623478 GTCTGCAAATATCTCAATCTTGG + Intergenic
1135436323 16:22429002-22429024 CTCTGCAAAGAAGGGAATCTGGG - Intronic
1137814969 16:51389881-51389903 CCCTGCAGACAGCTTGATCTTGG - Intergenic
1138372200 16:56536175-56536197 CTCTGCCAACACCTTGATCTTGG + Intergenic
1138763794 16:59575896-59575918 TTCTGAAAACAGATGAATATTGG + Intergenic
1140735832 16:77896943-77896965 CTTTGGAAACAGCAGAATCCTGG - Intronic
1141672651 16:85500793-85500815 CTCTGCAGACACCTCGATCTGGG - Intergenic
1142045537 16:87922836-87922858 CTCTGCAAAGAAGGGAATCTGGG - Intronic
1143508651 17:7383523-7383545 CTCTGCAAACAGCACCCTCTGGG - Exonic
1146450648 17:32971430-32971452 CTGTGCAAACAGCTGAATGGGGG + Intronic
1146973156 17:37089073-37089095 GCCTGCAAACAGATGACTCTTGG + Exonic
1147608864 17:41789696-41789718 CTGTGCAGACAGCTGAGTCTAGG - Intergenic
1148489652 17:48014781-48014803 GCCTGAAAACAGTTGAATCTGGG - Intergenic
1148489677 17:48014897-48014919 TTCTGGAAACTGCTGAATCCAGG - Intergenic
1148489686 17:48014953-48014975 GCCTGAAAACAGCTGAATCTGGG - Intergenic
1149537109 17:57441495-57441517 CTCTGCACTCAGCTGGAACTGGG + Intronic
1150522845 17:65887819-65887841 CTCTGGAAACAGGAGCATCTTGG + Intronic
1155325029 18:24656576-24656598 TCCTGCAAACAGCTGGCTCTGGG - Intergenic
1155427899 18:25725159-25725181 CTCTGCCATCATCTGCATCTGGG + Intergenic
1155685144 18:28539322-28539344 GTCTGCAAACAGCTGCATACTGG + Intergenic
1155945896 18:31851190-31851212 CTTTGAAAAATGCTGAATCTGGG - Intronic
1158613556 18:58965429-58965451 CTGTGCAAACTGCAGAGTCTGGG - Intronic
1158841668 18:61394575-61394597 CCCTGCAAACACCTTGATCTTGG + Intronic
1158900964 18:61961542-61961564 CTCTGCAATGTGCTGATTCTGGG + Intergenic
1160055488 18:75475570-75475592 CTCTATAAACAGATGAATCCTGG - Intergenic
1161895984 19:7080723-7080745 CAAGACAAACAGCTGAATCTGGG - Intronic
1163894253 19:20043658-20043680 CTGTGTAAACAACTGAATTTTGG - Intergenic
1166775352 19:45308711-45308733 ATCTGCAAAACGCTGAATCCTGG + Intronic
1166957665 19:46475776-46475798 CTCTGCAGAAAGCTGAAACCTGG - Intergenic
1167848582 19:52184578-52184600 CAAGGAAAACAGCTGAATCTTGG - Intergenic
925652842 2:6110063-6110085 CTCTGCAAGCAGCTGAAGATTGG - Intergenic
925739025 2:6989021-6989043 CTGGACAAACAGCTGATTCTAGG - Intronic
925914253 2:8593426-8593448 CCCTGCAGACACCTTAATCTTGG + Intergenic
926394169 2:12424267-12424289 CTCTGCTAACACCTTGATCTTGG - Intergenic
926811071 2:16755873-16755895 CTATGCAAACAGCTGAAGATGGG + Intergenic
927489456 2:23511079-23511101 CCCTGCCAACAGCTTCATCTTGG - Intronic
929955988 2:46459136-46459158 CCCTCAAAACAGCTGAGTCTGGG + Intronic
931786324 2:65622396-65622418 CTGTGCAACCAGCTGAATGCAGG + Intergenic
933634791 2:84696855-84696877 CTTTGCAACCACCTGCATCTTGG - Intronic
933861303 2:86471866-86471888 CTCTACTAACAGCTTATTCTGGG - Intronic
935303520 2:101715111-101715133 CTCTGCCAACACCTCAATCTTGG - Intronic
935886371 2:107623924-107623946 CACTGCAAACACCTTGATCTTGG + Intergenic
937123759 2:119459861-119459883 ATGTTCATACAGCTGAATCTTGG + Intronic
937493556 2:122394813-122394835 CTCTGCCAACGCCTTAATCTTGG - Intergenic
937663903 2:124462886-124462908 CACTGCAAACAGCTGCCTGTTGG + Intronic
937747334 2:125430242-125430264 ATCTGCAGACAGCTTGATCTAGG - Intergenic
940888647 2:159013851-159013873 CTCTGCCAACAGCTTGATCTGGG - Intronic
941094404 2:161219713-161219735 CACTGGATACAGCTGAATCAGGG - Intronic
941635945 2:167934925-167934947 CTCTGCCAACACCTTGATCTTGG + Intergenic
941924066 2:170878786-170878808 CTCTGCCAACACCTTGATCTTGG - Intergenic
942189276 2:173454993-173455015 CTCTGCCAACACCTTGATCTTGG - Intergenic
944118459 2:196213929-196213951 CTCTGCCACCAGCTAACTCTGGG - Intronic
944545628 2:200796444-200796466 ATCTGCTAGCAGCTGGATCTTGG + Intergenic
944621347 2:201518627-201518649 TTCTACAGACAGCTGACTCTTGG - Intronic
945158585 2:206865012-206865034 CACTGCACCCAGCTGAATTTGGG - Intergenic
946769743 2:223076588-223076610 CTCTGCCAACACCTTGATCTTGG + Intronic
948101733 2:235380166-235380188 CTCTTCGAACAGTTGAACCTTGG - Intergenic
948436726 2:237958789-237958811 CCCTGCCAACACCTGGATCTTGG - Intergenic
948648472 2:239424220-239424242 ATCTGCCAGCAACTGAATCTAGG + Intergenic
948872507 2:240810651-240810673 CTCTGCATTCATCTGCATCTTGG - Intronic
1168955330 20:1830477-1830499 CTCTGCTATCAGCAGAAACTGGG + Intergenic
1169545299 20:6643990-6644012 CTCTGAAAACACCTGTGTCTGGG + Intergenic
1169618079 20:7472179-7472201 CACAGCAAACTGCTGATTCTGGG + Intergenic
1173210845 20:41029851-41029873 CTCTGCAGAAAGCTCATTCTGGG - Intronic
1173272690 20:41552774-41552796 CTTTGCAAACAGCAGTACCTTGG - Intronic
1173422954 20:42918850-42918872 ATGGGCAAAAAGCTGAATCTGGG + Intronic
1174509046 20:51037307-51037329 CTGCGTAAACAGCTGAGTCTTGG + Intergenic
1174640081 20:52036216-52036238 CTCTGCAAAGACCTGTCTCTGGG + Intergenic
1175331134 20:58165081-58165103 TTCTGCCAACAAATGAATCTTGG + Intergenic
1177521494 21:22233587-22233609 ATCTGCTGACATCTGAATCTTGG + Intergenic
1177992459 21:28054777-28054799 CTCTGCATACTGGTGAATCCAGG - Intergenic
1179279035 21:39918033-39918055 CTCTGCCAACACGTTAATCTTGG + Intronic
1179333091 21:40424541-40424563 CCCTGCAGACACCTGAATTTTGG + Intronic
1179660589 21:42872275-42872297 CACTGCACCCAGCTGAATTTGGG + Intronic
1180758533 22:18180780-18180802 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1180768820 22:18364572-18364594 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1180777492 22:18497823-18497845 CTCTGCAAGCAGCTGGATGAAGG - Intergenic
1180810214 22:18755133-18755155 CTCTGCAAGCAGCTGGATGAAGG - Intergenic
1180826695 22:18867796-18867818 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1181196356 22:21189385-21189407 CTCTGCAAGCAGCTGGATGAAGG - Intergenic
1181213171 22:21303739-21303761 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1181610848 22:24010899-24010921 CTCTGAAAACAGTGGAAACTTGG - Intergenic
1183568324 22:38632702-38632724 CTATGCAAACAGCACTATCTTGG - Intronic
1203230442 22_KI270731v1_random:105456-105478 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1203276838 22_KI270734v1_random:93706-93728 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
949741805 3:7243225-7243247 CTCTGCTACCAGTTGAATTTAGG - Intronic
950433400 3:12964773-12964795 CTCTGCATACTGTGGAATCTTGG - Intronic
951292059 3:20883340-20883362 CTATGAAAATAGCTGAATCTGGG - Intergenic
952195007 3:31065983-31066005 CTCTGGGACCAGCTGAGTCTAGG - Intergenic
952808393 3:37378951-37378973 CTCTGCAAGCAGCTGCATTTTGG + Intergenic
952828086 3:37540585-37540607 CCCATCAAACAGCTGAATCTAGG - Intronic
954379971 3:50214141-50214163 CTCTGCAGACATCTGACTGTTGG + Exonic
955036651 3:55274480-55274502 CTCTGCACACCACTGACTCTTGG + Intergenic
955396549 3:58561851-58561873 CTCTGCAGACAGGTCACTCTGGG + Intergenic
960090574 3:113634366-113634388 CACTGCATCCAGCTGAATGTTGG - Intergenic
960953278 3:123013334-123013356 TTCTGCAAACTGCTGAGTCCTGG + Intronic
961925872 3:130479489-130479511 CTATGGAAAGAGCTGTATCTTGG + Intronic
962503683 3:136023349-136023371 TTCTGCAAATAGCTGAATAGAGG - Intronic
963023860 3:140899528-140899550 CTCTGCAAACAGCTGCCCCTTGG + Intergenic
963305371 3:143645865-143645887 CTCATTAAACAGCTGACTCTTGG - Intronic
963399602 3:144780786-144780808 CTCTTCAAACAGCTTATTTTGGG + Intergenic
964874980 3:161357080-161357102 CTCTGCCAACCCCTGAATCAAGG + Intronic
964892602 3:161554966-161554988 CTATGCAAACCGCTGAACCTTGG - Intergenic
965509041 3:169547951-169547973 CTCTGCAAACACCTAGATTTTGG + Intronic
965631751 3:170740398-170740420 CTCTGCCAACACCTTGATCTTGG - Intronic
966565803 3:181379727-181379749 CTCTGAAGACTGCTGAATTTAGG - Intergenic
967630725 3:191740807-191740829 CCATGCAAACAGCTGAATGGGGG - Intergenic
969856152 4:10001448-10001470 CTCTGCCAACACCTTGATCTTGG + Intronic
969947855 4:10802696-10802718 CCCTGCTAACAGCTGGATTTTGG + Intergenic
970139250 4:12962580-12962602 CTCTGGAAAGAGCTCAGTCTTGG + Intergenic
971139813 4:23912222-23912244 CTCTGCAACAAGCTGTCTCTTGG - Intergenic
972139604 4:35941334-35941356 CCCTGCTAACACCTTAATCTTGG + Intergenic
972182613 4:36487750-36487772 CGCTGAAAAAAGCTAAATCTAGG + Intergenic
972863493 4:43201692-43201714 ATCTGCAGGCAGCTGGATCTTGG + Intergenic
978013864 4:103720129-103720151 CGCTGCAAGCAGCTGGAGCTTGG + Intergenic
978706089 4:111713410-111713432 CTGTCCAAACGTCTGAATCTGGG + Intergenic
979192368 4:117877547-117877569 ATCTGCAAAAATCAGAATCTTGG + Intergenic
980651507 4:135722169-135722191 ACCTGCAAACAACTTAATCTTGG + Intergenic
982434438 4:155367437-155367459 CCCTGCAAACACCTTGATCTTGG + Intronic
982599545 4:157429686-157429708 CCCTGCTAACAGCTTGATCTTGG - Intergenic
987312410 5:16693442-16693464 CTCTGCAGACGGCAGAATATTGG - Intronic
988005311 5:25402867-25402889 CTCTAAAAACAGCTCAAGCTAGG - Intergenic
988442389 5:31247389-31247411 CTTTGCAATCAGCTGGATATGGG - Intronic
988878756 5:35476761-35476783 CTTTGCAAACAGCCCAAGCTAGG - Intergenic
990542173 5:56784474-56784496 CTCATCAAACTGCAGAATCTCGG - Intergenic
991374552 5:65953199-65953221 CTCTGCATACAGTTGACTCTTGG + Intronic
991603661 5:68378892-68378914 CTCTGCAAACAACAGTAGCTGGG + Intergenic
997786083 5:136715279-136715301 CTGTGAAAACAGCTGCACCTGGG - Intergenic
998248336 5:140530513-140530535 CTCTTCAAATAGCTGTATCTAGG - Intronic
999337246 5:150732437-150732459 CACTGCACCCAGCTTAATCTAGG + Intronic
999606591 5:153323594-153323616 CTCTGAAGACAGCTGAAGATAGG - Intergenic
999693490 5:154168573-154168595 CTCTGCAAACAGCTGAATCTTGG + Intronic
1000016384 5:157281310-157281332 CTCTACAAACAAATGGATCTAGG - Intronic
1002398369 5:178975811-178975833 CTCTACAATCAGCTGACTTTAGG + Intergenic
1002892715 6:1349884-1349906 TCGTGTAAACAGCTGAATCTAGG + Intergenic
1003502286 6:6712536-6712558 CTCTGCACACAGCAGAGGCTTGG + Intergenic
1004739660 6:18446498-18446520 CTCTGGAAACACCTGAATGTAGG + Intronic
1006241945 6:32689722-32689744 ATCTGCAAATGGCTGAATCTGGG - Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1008845516 6:55958314-55958336 CTCTGAAATCAGCTGAATCATGG + Intergenic
1011670231 6:89676300-89676322 CTATTCAGACAGCTGACTCTTGG - Intronic
1013067560 6:106698533-106698555 CTCTGCCAATGACTGAATCTTGG + Intergenic
1015514728 6:134072694-134072716 CTCTGCTGACACCTGGATCTTGG - Intergenic
1016023220 6:139257473-139257495 TTGTGCAAAGAGCTGATTCTTGG + Intronic
1016256242 6:142109113-142109135 CTATGAAAACAGCTGAAGCAGGG - Intergenic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1017035893 6:150266992-150267014 CCCTGCCAACATCTTAATCTTGG - Intergenic
1017349784 6:153426695-153426717 CTCTGCTAACACCTTGATCTTGG + Intergenic
1017878505 6:158543518-158543540 CTCTGCCAACACCTGGATTTCGG - Intronic
1018654650 6:166024025-166024047 ATCTGCAAGCACCTTAATCTTGG - Intergenic
1019938425 7:4271132-4271154 CTCTGAAAGGAACTGAATCTGGG + Intergenic
1020157614 7:5739507-5739529 CTATGTAGACAGATGAATCTGGG - Intronic
1022280316 7:28901599-28901621 CTCTGCCAACACCTTATTCTTGG + Intergenic
1024176331 7:46844605-46844627 CCCTGCCAACAGCTTGATCTTGG - Intergenic
1028483189 7:91330399-91330421 CTCTGAAAATAGTTTAATCTTGG + Intergenic
1029877425 7:103769206-103769228 CTCTGGCAACACCTGAATTTTGG - Intronic
1031586761 7:123539780-123539802 TTCTGCAAAGAGCTGCATATAGG - Exonic
1032552466 7:132797196-132797218 CCCTGCACACAGCTGAAGCCTGG + Intronic
1033040882 7:137917112-137917134 CTGAGAAAACAGCTGCATCTTGG + Intronic
1033710731 7:143940155-143940177 CTCTGAAATCATCTCAATCTCGG + Intergenic
1036489832 8:9214654-9214676 CTCTGCCAACACCTCGATCTAGG + Intergenic
1038279662 8:26152540-26152562 GTCTGCAAAGAGATGAATGTGGG + Intergenic
1038284810 8:26197328-26197350 CTCTGCTGACACCTGGATCTTGG - Intergenic
1039861884 8:41466206-41466228 ATCTGCCAACAGCTTGATCTGGG + Intergenic
1041766088 8:61419677-61419699 CTCTGAAAGCAGCTGACTCTAGG + Intronic
1042092925 8:65178660-65178682 CTCTGCTGACAGCTTAATCTTGG - Intergenic
1042672491 8:71280156-71280178 CTTTGTAGTCAGCTGAATCTAGG + Intronic
1047619566 8:126592332-126592354 TTCTGAAAACAGCTGATTGTAGG - Intergenic
1048549335 8:135419527-135419549 CTTTGCAATCAGCTGGAGCTAGG + Intergenic
1050173331 9:2844854-2844876 CTCTGCCAACAGCTTGATTTTGG - Intergenic
1051811201 9:21052201-21052223 CTCTGCCAACACCTTAATTTGGG - Intergenic
1056761803 9:89420720-89420742 CTCTGCAATCAGAGGAACCTGGG + Intronic
1056832051 9:89925026-89925048 CCCTGCCAACACCTGGATCTTGG - Intergenic
1058969013 9:110063294-110063316 CCCTGCAAACACCTGGATCTTGG - Intronic
1059723091 9:116980595-116980617 CAATGCAAACAGCAGAGTCTTGG - Intronic
1185924056 X:4127175-4127197 CCCTGCCAACAGCTCCATCTTGG - Intergenic
1186345221 X:8684948-8684970 GTCTGCAGAAGGCTGAATCTGGG + Intronic
1186387016 X:9120282-9120304 CTTTGGAAACAGGTAAATCTGGG + Intronic
1188046262 X:25428741-25428763 CTCTGCAAATTGCTGACTCCAGG - Intergenic
1189211802 X:39290158-39290180 CTCTGCCAACACCTTGATCTTGG - Intergenic
1189705231 X:43752886-43752908 CTCTGCACACAACTGAATACTGG + Intergenic
1189714756 X:43853843-43853865 CTCTGCAAACACTTTGATCTTGG + Intronic
1190125137 X:47698181-47698203 CTCTTCTACCAGCTGAGTCTGGG - Intergenic
1192430584 X:71108914-71108936 CTTTGGAACCAGCTGGATCTAGG - Intronic
1194631739 X:96293716-96293738 ATATGCAGACAGCTGAAACTAGG + Intergenic
1195619118 X:106935548-106935570 CTCTGGAGTCAGATGAATCTGGG + Intronic
1196693440 X:118585307-118585329 CCCTGCAAACACCTTAATTTTGG - Intronic
1197265562 X:124366274-124366296 CTTTGTCAACAGGTGAATCTGGG + Intronic
1197269050 X:124406040-124406062 CTTTGCAAACAGCTGGGTATTGG + Intronic
1199673268 X:150164069-150164091 CTCAGCAAGGAGCTGAATCTGGG - Intergenic