ID: 999694320

View in Genome Browser
Species Human (GRCh38)
Location 5:154175309-154175331
Sequence TATATGAACATGCATTCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999694318_999694320 -4 Left 999694318 5:154175290-154175312 CCCACTGAGTGTATGTGTGTATA 0: 1
1: 1
2: 3
3: 79
4: 604
Right 999694320 5:154175309-154175331 TATATGAACATGCATTCAGTAGG No data
999694319_999694320 -5 Left 999694319 5:154175291-154175313 CCACTGAGTGTATGTGTGTATAT 0: 1
1: 3
2: 26
3: 235
4: 1934
Right 999694320 5:154175309-154175331 TATATGAACATGCATTCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999694320 Original CRISPR TATATGAACATGCATTCAGT AGG Intronic
No off target data available for this crispr