ID: 999695299

View in Genome Browser
Species Human (GRCh38)
Location 5:154183538-154183560
Sequence TAGGGCAGTAAAACTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999695299 Original CRISPR TAGGGCAGTAAAACTGAGGC AGG Intronic
900207062 1:1436111-1436133 AAGGGTAGGGAAACTGAGGCAGG - Intronic
901861308 1:12076394-12076416 TTGGAGAATAAAACTGAGGCCGG - Intronic
903592135 1:24464729-24464751 TAGGTCAGCAAATCTGAGGTTGG - Intronic
904025297 1:27499045-27499067 GAAGGGGGTAAAACTGAGGCAGG - Intergenic
905913975 1:41672403-41672425 CAGGGCAGAGAAGCTGAGGCCGG - Intronic
907491648 1:54812355-54812377 TAGGTAGGGAAAACTGAGGCTGG + Intronic
907742730 1:57182951-57182973 TTGAGCAGTTAAAATGAGGCTGG - Intronic
911846476 1:102758515-102758537 TAAGACATTAAAATTGAGGCTGG + Intergenic
915414084 1:155726586-155726608 TAGGAAAGTAAAGCTGAGGCCGG - Intronic
916084613 1:161259287-161259309 TCGGGCAGTAAGACAGATGCAGG - Intronic
916814950 1:168342705-168342727 ACGGGCAGAAAAACGGAGGCTGG - Intergenic
918414333 1:184291030-184291052 TAGGGCAGGAAAACTGTAGATGG - Intergenic
919926576 1:202194666-202194688 CAGGGCTGTCACACTGAGGCTGG + Intronic
922538469 1:226401178-226401200 TAGAGCAGTGAAACTGATGCAGG + Intronic
1062953351 10:1522415-1522437 GAGGGCAGTAAAACAAAGGGTGG + Intronic
1064951882 10:20861473-20861495 GAGGGCAATAAGACTGTGGCTGG - Intronic
1069317846 10:67130154-67130176 TAGAGGAGCAACACTGAGGCAGG - Intronic
1070798640 10:79231919-79231941 TAGTCCAGTGAGACTGAGGCTGG + Intronic
1071087851 10:81884162-81884184 TAGGTAAGTAAGACTGAGGTGGG - Intronic
1071438288 10:85666980-85667002 TAGGGCAGTAGCACTGATGTTGG - Intronic
1073465798 10:103693915-103693937 CAGGGCAGGTAAACGGAGGCTGG - Intronic
1073930378 10:108567526-108567548 TATGGCAGGAAATCTGTGGCCGG - Intergenic
1077383198 11:2257067-2257089 GAGGGCAGTGAGGCTGAGGCTGG + Intergenic
1077670900 11:4156748-4156770 CAGGGCAGTAACAGTGAGGTTGG - Intergenic
1078806304 11:14708602-14708624 TAGTACAGTAAATCTGATGCAGG + Intronic
1079582249 11:22080260-22080282 GGGGGCAATATAACTGAGGCAGG - Intergenic
1080386248 11:31812745-31812767 TAGGGCTGAAGAGCTGAGGCAGG + Intronic
1081665826 11:44916593-44916615 TCTGGCAAGAAAACTGAGGCTGG + Intronic
1081857964 11:46315950-46315972 AAGGTCAGTGAAACTGTGGCAGG + Intronic
1083726725 11:64632336-64632358 TAAAGCAGGGAAACTGAGGCTGG + Intronic
1083967071 11:66049444-66049466 TCAGGCAGGGAAACTGAGGCCGG + Intergenic
1084131879 11:67142352-67142374 TAGGGCATTAAAAATAAGGCTGG + Intronic
1089120084 11:116127698-116127720 TACTGCAGGTAAACTGAGGCAGG + Intergenic
1089793186 11:120958921-120958943 TAGGGCAGAAGAGCTGAGGCAGG + Intronic
1090043325 11:123309798-123309820 TGGGGAAGGATAACTGAGGCAGG + Intergenic
1092149214 12:6235735-6235757 AAGGGCAATAAAACAAAGGCCGG + Intronic
1092215517 12:6679062-6679084 GAGGGCAGGGACACTGAGGCAGG + Exonic
1093374127 12:18403379-18403401 TAGTTCAGTAAAACTGAGAGTGG - Intronic
1095671746 12:44869517-44869539 TATGGCAGTAAAATTGCTGCTGG - Intronic
1096814828 12:54195610-54195632 TAGGGGAGGAAAACTGGGGAGGG - Intergenic
1099368599 12:81801119-81801141 TGGGGCAGTGATTCTGAGGCTGG + Intergenic
1101193593 12:102360315-102360337 AAAGGGAGAAAAACTGAGGCAGG + Intergenic
1105802875 13:23924715-23924737 TAGGGGTGGAAAACTGAGGCTGG - Intergenic
1107354065 13:39547024-39547046 TAGGGCAGAAAATTGGAGGCAGG - Intronic
1107452429 13:40521988-40522010 AAGGGCAAAAACACTGAGGCAGG - Intergenic
1108878059 13:55073006-55073028 TAGGGCACAAAAACTGAGGATGG + Intergenic
1109068861 13:57737320-57737342 GAGGCCAGTAAAAGTCAGGCAGG - Intergenic
1117273690 14:54170676-54170698 TGGGGTATTAAAACTGAGCCAGG + Intergenic
1118194945 14:63616470-63616492 TAAGGCAAGAAAAATGAGGCAGG + Intronic
1118807961 14:69254145-69254167 TAGAGCAGTAACACTGAAGCAGG - Intergenic
1120070888 14:80100858-80100880 TGGGGCAGTTAAACAAAGGCAGG - Intergenic
1122380180 14:101297806-101297828 TACCTCAGTAAAACTGAGGGAGG + Intergenic
1122836714 14:104434241-104434263 TGGGGCAGGAAAGCTCAGGCTGG - Intergenic
1125094563 15:35836091-35836113 TTGTGCAGTAACACTGAGGCAGG + Intergenic
1125745045 15:41992242-41992264 TGGGGCAGGGATACTGAGGCTGG + Intronic
1125931775 15:43605225-43605247 CAGGGCAGCAAATCTGAGTCTGG + Intronic
1125944875 15:43704703-43704725 CAGGGCAGCAAATCTGAGTCTGG + Intergenic
1126396359 15:48222662-48222684 AAGGCCAGTAAAACTGAGTAAGG - Intronic
1127198040 15:56611705-56611727 GAGGGCTGGGAAACTGAGGCTGG + Intergenic
1130552404 15:84898822-84898844 CAGGGAAGGAAAACTGAGGTGGG + Intronic
1130888790 15:88115795-88115817 TAGGGCAGTGTCTCTGAGGCCGG + Intronic
1133101168 16:3481023-3481045 TAGGGCAGAAAAAGTGACTCAGG - Intronic
1135110525 16:19687346-19687368 CAGGGCAGCAAAACTGCAGCTGG - Intronic
1138213227 16:55180466-55180488 TAGGGGAGAAAACCTGGGGCAGG - Intergenic
1140127173 16:72127504-72127526 TAAGACACTAAAACTGAGGATGG + Intronic
1145093304 17:20003605-20003627 GACGGCAGTAGACCTGAGGCAGG + Intergenic
1147474051 17:40693092-40693114 TTGGCCACTAAAACTGAAGCTGG - Intergenic
1148517610 17:48235659-48235681 TAGTGCAGCAAAGCTGAGGATGG + Intronic
1149033617 17:52110606-52110628 TAGGGAAGTAAGACAGAGTCGGG + Intronic
1150843126 17:68628089-68628111 CAGGGCAGTAAAGGTGAGTCTGG - Intergenic
1156926109 18:42581864-42581886 TAGGGCTGGAAGACTGAGGCAGG + Intergenic
1157141540 18:45112571-45112593 TACGGAAGTGAAATTGAGGCAGG + Intergenic
1158112841 18:53960777-53960799 TAGGCAAGGAAAACTCAGGCAGG + Intergenic
1161283717 19:3458515-3458537 GAGGGAAGGGAAACTGAGGCAGG + Intronic
1161660136 19:5540729-5540751 TAAGGGAGGGAAACTGAGGCTGG + Intergenic
1166068653 19:40375204-40375226 GAGGGCAGGAAGCCTGAGGCAGG + Intronic
1167673342 19:50869147-50869169 GTGGGCAGTAAGACTGAGGAAGG - Intronic
929672129 2:43884480-43884502 AAGGGCAGGAAGACTGAAGCTGG + Intergenic
931700589 2:64905749-64905771 AAGGGCAGCAAAACTTAGACTGG + Intergenic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
932839907 2:75072457-75072479 TAGGGCAGAAAAGTTGAGGTTGG + Intronic
939955043 2:148520673-148520695 TAGGTTAGTAAAACTAAGGCGGG - Intergenic
942207793 2:173639180-173639202 GAGGGCAGGAAATCAGAGGCAGG + Intergenic
946723330 2:222635188-222635210 TAGGGATGTAAAACCGAGCCAGG + Intronic
947227209 2:227852216-227852238 TAGGGCTGAACATCTGAGGCTGG + Intergenic
1172909759 20:38399309-38399331 TGGGGCAGTCAAACTGAGGGTGG - Intergenic
1173632369 20:44526324-44526346 TAAGGCAGGAAAACAGAGTCTGG + Intergenic
1176515858 21:7782945-7782967 GGAGGCTGTAAAACTGAGGCAGG - Intergenic
1178649886 21:34412957-34412979 GGAGGCTGTAAAACTGAGGCAGG - Intergenic
1179530291 21:42013833-42013855 GAAGGAAGCAAAACTGAGGCAGG - Intergenic
1180307714 22:11143392-11143414 TCAGGCAGTAAATATGAGGCAGG - Intergenic
1180546234 22:16505615-16505637 TCAGGCAGTAAATATGAGGCAGG - Intergenic
1180814862 22:18782969-18782991 TGGGGCAGTAGAAAAGAGGCAGG - Intergenic
1181339169 22:22164882-22164904 TAGAGCAGTGATAATGAGGCAGG + Intergenic
1183599024 22:38829360-38829382 AAGGGCAGCAGAACTGGGGCAGG + Intronic
1185276833 22:49953540-49953562 TAGGGAAGTGGACCTGAGGCCGG + Intergenic
952347171 3:32498872-32498894 AAAGGTAGTGAAACTGAGGCCGG - Intronic
956319348 3:67979115-67979137 CAGGGCTCTAAAACAGAGGCAGG - Intergenic
957831829 3:85531614-85531636 GAGGGCAAAAAAACAGAGGCTGG - Intronic
959489261 3:106968512-106968534 TAGGACAATAAAACAGTGGCTGG - Intergenic
960045898 3:113197919-113197941 TGGGGCAGGAAAAATGAGCCAGG - Intergenic
964773144 3:160245581-160245603 TTGGGGAAAAAAACTGAGGCAGG - Intronic
964775687 3:160274172-160274194 TAGGGAAGTAAAGATGAGGGAGG + Intronic
964785464 3:160391273-160391295 TTGGGCAGTATATCTGATGCAGG - Intronic
966377838 3:179315090-179315112 AAGAGCAGAAAAACTAAGGCCGG + Intergenic
966653285 3:182325243-182325265 AAGGGAAATAAAGCTGAGGCAGG + Intergenic
968805109 4:2767174-2767196 TGGGGCAGGAAGGCTGAGGCTGG + Intergenic
969173525 4:5382633-5382655 GAAAGCAGTAAAACTGAGACTGG - Intronic
970133850 4:12900412-12900434 CAGGAAAGTAAAACTGAGTCTGG - Intergenic
970947463 4:21711905-21711927 AAGGATAGGAAAACTGAGGCTGG + Intronic
971938962 4:33189386-33189408 TAGTGCAGTTAAACAGAGGGGGG - Intergenic
978781281 4:112557661-112557683 TAGGGCAAGAACACTGAGGCTGG + Intronic
981238823 4:142450149-142450171 TTGGGCAGCAGAGCTGAGGCTGG - Intronic
982597992 4:157409354-157409376 TCAGACAGTGAAACTGAGGCTGG + Intergenic
983115288 4:163808323-163808345 TAGGTCAGTTAAGCTGGGGCAGG - Intronic
986095202 5:4547720-4547742 TGGAGCAGCAAAACTGAAGCTGG - Intergenic
986596654 5:9429768-9429790 GAGGCCAGTGAAACTGAAGCTGG + Intronic
991247216 5:64520871-64520893 TAAGGAAGTAACATTGAGGCTGG + Intronic
991602910 5:68371261-68371283 TTGGGAACTGAAACTGAGGCAGG - Intergenic
991613579 5:68473052-68473074 GAGGGCACTAAAACTGATGTTGG - Intergenic
992326533 5:75665547-75665569 TGTGGAAGTAAAGCTGAGGCTGG + Intronic
993855814 5:93073521-93073543 AAAGGCAGAAAAACAGAGGCAGG - Intergenic
995809604 5:116089984-116090006 TAGAATAGTGAAACTGAGGCAGG + Intronic
999695299 5:154183538-154183560 TAGGGCAGTAAAACTGAGGCAGG + Intronic
1001107048 5:168863350-168863372 TTGGGCAAAAGAACTGAGGCCGG + Intronic
1001478748 5:172071310-172071332 TAGATAACTAAAACTGAGGCAGG + Intronic
1002069572 5:176671395-176671417 TAAGGCAGTCAAAGTCAGGCCGG - Intergenic
1002327309 5:178418330-178418352 TAGGGCAAGAAAACTGAGGGTGG - Intronic
1005610506 6:27519259-27519281 TAGGGCCGCAGAACCGAGGCTGG + Intergenic
1010686299 6:78858351-78858373 TTGGGAAAAAAAACTGAGGCAGG + Intergenic
1010921399 6:81686147-81686169 CAGGGCAGTAACAATGAGGGTGG - Intronic
1012099194 6:95009108-95009130 TAGAGCAGAAAAATTGAGGATGG + Intergenic
1013027325 6:106289276-106289298 TAAGGCAGTACAATAGAGGCAGG + Intronic
1015332853 6:132001649-132001671 GAGGGCAGGGAAAATGAGGCTGG + Intergenic
1015370099 6:132440832-132440854 GAGGGCAGGGAAAATGAGGCTGG - Intergenic
1016964994 6:149710593-149710615 TAAGGCAGTATCACTAAGGCAGG - Intronic
1018609564 6:165634598-165634620 TAGGGAAGTAAAACAGAAGCAGG + Intronic
1019127625 6:169851591-169851613 TTGCCCAGTGAAACTGAGGCTGG - Intergenic
1022595411 7:31708930-31708952 GAGGGGAATAAAACTGTGGCCGG + Intergenic
1023188855 7:37557958-37557980 TAGGGCATTAAAAAAGAGGCAGG + Intergenic
1027197774 7:76042947-76042969 TTGGGCTGGAAATCTGAGGCTGG + Intronic
1027952633 7:84836830-84836852 AAGAAAAGTAAAACTGAGGCTGG - Intergenic
1036393744 8:8348668-8348690 TAGGTAAGTGAAACTGATGCTGG - Intronic
1036931522 8:12960845-12960867 TAGGGCAATAAAACTGGGCTGGG + Intronic
1040666250 8:49637331-49637353 GAGTGTAGTAAAACTGAAGCTGG - Intergenic
1041668123 8:60465839-60465861 CAGGTCAATAAAAATGAGGCCGG + Intergenic
1042999235 8:74736893-74736915 AAGGGCACTTACACTGAGGCAGG + Intronic
1044778712 8:95721574-95721596 AAGGGCATTTAAACTGAGTCAGG + Intergenic
1044923443 8:97188989-97189011 TGGGGCAGTAAGACTGAGATGGG - Intergenic
1045535985 8:103028313-103028335 TAAGGCAGAAAAACTCAGACAGG + Intronic
1047233494 8:123018085-123018107 GAGGGCAGTAAAACTTGAGCAGG - Intronic
1049912863 9:286457-286479 CAGGGTCATAAAACTGAGGCTGG - Exonic
1050043428 9:1519470-1519492 TTTGGCAGGAAAACTAAGGCAGG - Intergenic
1050244730 9:3676790-3676812 TGGGGCAGGCATACTGAGGCAGG + Intergenic
1050587992 9:7133106-7133128 TAGGGGAAAAAAACTGGGGCTGG - Intergenic
1050631300 9:7561532-7561554 TAGGGAAATAAAACTGAGAAAGG + Intergenic
1052496681 9:29234931-29234953 TAGGGAAGAAAAATTAAGGCGGG - Intergenic
1053285685 9:36848251-36848273 TGGGGCAGGAATAATGAGGCAGG + Intronic
1055119941 9:72648291-72648313 GAAGGCATTAAAAATGAGGCAGG + Intronic
1055457212 9:76484082-76484104 TCAGAAAGTAAAACTGAGGCTGG + Intronic
1056387868 9:86114076-86114098 TTAGGAATTAAAACTGAGGCCGG + Intergenic
1057076778 9:92142115-92142137 CAGGGCTGTCACACTGAGGCTGG + Intergenic
1058083857 9:100727935-100727957 AAAGGCAGGCAAACTGAGGCAGG - Intergenic
1058095150 9:100851678-100851700 TAGGACAATAAAACTGAGAATGG - Intergenic
1058454770 9:105128908-105128930 TAGGGAAGGAAAACTGAGCTGGG + Intergenic
1058967367 9:110049761-110049783 GAGGGGAGTAAAACGGAGCCCGG + Intronic
1060299748 9:122368269-122368291 GAAGGCAGGGAAACTGAGGCAGG + Intergenic
1060423863 9:123488574-123488596 TACAGAACTAAAACTGAGGCAGG - Intronic
1061210518 9:129189729-129189751 CAGGGCCTTAAAAATGAGGCTGG + Intergenic
1186397517 X:9224815-9224837 AATGTCAGTAGAACTGAGGCTGG - Intergenic
1189921434 X:45906649-45906671 GAGGGGAATAGAACTGAGGCAGG - Intergenic
1190298862 X:49044242-49044264 CAGGCCAGGAAAGCTGAGGCTGG - Intergenic
1196481679 X:116157444-116157466 TAAGACAGCAAACCTGAGGCAGG - Intergenic
1198748415 X:139914143-139914165 AAGGGCAATAGAACTGAGCCTGG + Intronic
1200068219 X:153515076-153515098 CAGGGGAGAAAATCTGAGGCAGG - Intergenic
1201493371 Y:14567040-14567062 TAGGGCAGGAAATATGAAGCTGG - Intronic