ID: 999696039

View in Genome Browser
Species Human (GRCh38)
Location 5:154189929-154189951
Sequence CATTCTAACTCCAAGGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999696032_999696039 3 Left 999696032 5:154189903-154189925 CCAAAAGCACGCGTGAGAATGCA 0: 1
1: 0
2: 0
3: 3
4: 60
Right 999696039 5:154189929-154189951 CATTCTAACTCCAAGGGGGTTGG 0: 1
1: 0
2: 0
3: 4
4: 95
999696030_999696039 30 Left 999696030 5:154189876-154189898 CCGGGAAGGGCTCAGTGCGCTTA 0: 1
1: 0
2: 2
3: 7
4: 93
Right 999696039 5:154189929-154189951 CATTCTAACTCCAAGGGGGTTGG 0: 1
1: 0
2: 0
3: 4
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999696039 Original CRISPR CATTCTAACTCCAAGGGGGT TGG Intronic
901908879 1:12438203-12438225 AATTCTAACCCCAAAGGTGTTGG + Intronic
903265664 1:22156552-22156574 ACCTCTAACTTCAAGGGGGTGGG - Intergenic
907115466 1:51964377-51964399 CATTCCAACACCAAGGTGTTGGG - Intronic
908297674 1:62729228-62729250 CATTTTAACACAAAGGTGGTAGG - Intergenic
913530247 1:119728909-119728931 CCTTCTAACTCTAAGAAGGTAGG - Intronic
918167253 1:181961853-181961875 CTTGCTGGCTCCAAGGGGGTGGG + Intergenic
919287010 1:195576983-195577005 CATTCTAACTTGAATTGGGTTGG + Intergenic
919776322 1:201196252-201196274 CTTTCTAAAGCCAAGGTGGTGGG - Intronic
923021150 1:230164840-230164862 CTTTCTAATTCCAAGGGAGAAGG + Intronic
1064098962 10:12446760-12446782 AGTTCTAACTCCAAAGGGCTTGG - Intronic
1068998799 10:63240062-63240084 AATTTTAACTCCATGGGGGCAGG + Intronic
1071926564 10:90416031-90416053 AATTCTAACTGCACCGGGGTGGG + Intergenic
1075089709 10:119436868-119436890 AAGTCTAAGTCCGAGGGGGTGGG + Intronic
1076485041 10:130810397-130810419 CATTCTCAGCCCAGGGGGGTAGG - Intergenic
1082785026 11:57311977-57311999 AGTTCTACCTCCAAGGGTGTTGG - Intronic
1084234799 11:67780337-67780359 CATTCTATCTAGAAGGGGTTTGG - Intergenic
1097013988 12:55972424-55972446 ACTTCTAACTCCTATGGGGTAGG - Exonic
1098454063 12:70652581-70652603 CATTCAAACTCAAGGGGGTTGGG + Intronic
1101831821 12:108263783-108263805 CACTGTAACCCCAAGGTGGTGGG + Intergenic
1103348041 12:120264522-120264544 GACTCTAAACCCAAGGGGGTTGG - Intronic
1107088242 13:36448542-36448564 CATTCTGACTGCAGGGGGCTGGG + Intergenic
1107838210 13:44429198-44429220 ACTCCTAACTCCAAGGGGGCGGG + Intergenic
1109041761 13:57347652-57347674 CACTCTAACTCCAAGGTGAAAGG + Intergenic
1110369844 13:74727674-74727696 CATTCTACCTCCAAGATGATTGG + Intergenic
1111509440 13:89241957-89241979 CATTCTTTCTCCAAGGGTATGGG + Intergenic
1113318613 13:109209856-109209878 CAATCTATCTACAAGCGGGTTGG - Intergenic
1115270346 14:31544644-31544666 CATTCTGACTCCATGGGGAGAGG - Intronic
1116732020 14:48635577-48635599 CATTTTAACTCCAAGGTGTCAGG + Intergenic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1119617257 14:76107099-76107121 CACTGTCACTCCATGGGGGTTGG + Intergenic
1119849268 14:77855254-77855276 CATACTTACTACAAGGGGATTGG - Intronic
1119861077 14:77936544-77936566 CATTATCACTGCTAGGGGGTGGG - Intergenic
1127196973 15:56597739-56597761 TATCCTAGCTCAAAGGGGGTTGG + Intergenic
1128704538 15:69828978-69829000 CATTTTAAAACAAAGGGGGTAGG + Intergenic
1128788870 15:70418079-70418101 CATTCTGGCTCCCAGTGGGTTGG - Intergenic
1130118885 15:81029599-81029621 CCACCTAACTACAAGGGGGTAGG - Intronic
1131600002 15:93837593-93837615 CATCCAAACTCCAAGGGATTAGG + Intergenic
1132928559 16:2446342-2446364 CTCTCTAACTCCAAGAGTGTAGG - Intronic
1133495834 16:6316175-6316197 CATCCTATACCCAAGGGGGTTGG - Intronic
1146062922 17:29616391-29616413 CTGTCTAAGACCAAGGGGGTTGG + Intronic
1148207439 17:45787942-45787964 CATTTCAAATCCAAGGGGCTTGG - Intronic
1157878323 18:51294369-51294391 CATACCACCTCCAAGGGGTTTGG + Intergenic
1159353098 18:67300070-67300092 CATTGTAACTCCCTGGGGGGAGG + Intergenic
1160328434 18:77970387-77970409 CATTTCACCTCCAAGGGTGTGGG - Intergenic
1162568186 19:11455674-11455696 CTTTGGAACTCCAAGGTGGTAGG - Intronic
1165336500 19:35173795-35173817 CATTCTATCTTCCATGGGGTCGG + Intergenic
1167238380 19:48328534-48328556 CATCCAAATTCCAAGGGGATGGG + Intronic
925622532 2:5807833-5807855 AATTCTAAGTCCCAGGTGGTGGG + Intergenic
927495378 2:23548468-23548490 CGATCTAACTCTAAGTGGGTGGG - Intronic
930154267 2:48089946-48089968 CATTCTGACTGAAAGGAGGTAGG + Intergenic
931325058 2:61212924-61212946 CTTTCTGACTTCAAAGGGGTCGG - Intronic
931774936 2:65532481-65532503 CATCCCAACTCCAAGAGTGTTGG - Intergenic
944987747 2:205197679-205197701 CATGCTAATTCAAAGGGGTTAGG + Intronic
945592636 2:211753601-211753623 CAATCTAATTCCCAGGGGCTTGG + Intronic
948097630 2:235349121-235349143 CATAATAACACCAAGGGGGATGG - Intergenic
948391424 2:237614156-237614178 CATTCTGATTCCAGGGGGGAAGG + Intergenic
1172003349 20:31799096-31799118 CACTGTAACTCCAAGGAGTTTGG - Intronic
1179336605 21:40462541-40462563 CATTCTAATTCCATGGGTCTTGG - Intronic
1180943883 22:19679128-19679150 AATTCTAACCCCTAGGGGGGTGG + Intergenic
1182115052 22:27751623-27751645 CATACCAACTCCAGGGGGGAAGG + Intronic
949555818 3:5151722-5151744 GATCCTATCTCCAAGGGGGGGGG - Intronic
960395501 3:117131815-117131837 CATTTTTACTCCATGGGGGTGGG - Intronic
961600769 3:128059964-128059986 GATACTACCTCCAAGGGGCTCGG - Intronic
961884429 3:130086872-130086894 CATTCTATCTAGAAGGGGTTTGG - Intronic
962066055 3:131981524-131981546 CAGTCTCACTCCAAAGGGCTTGG + Intronic
965459709 3:168946909-168946931 CATAGTAACTCCAAAGGGCTTGG - Intergenic
969820347 4:9715411-9715433 CATTCTATCTAGAAGGGGTTTGG + Intergenic
978733712 4:112061498-112061520 CACTTTAGCTCCAAGGTGGTGGG - Intergenic
978749822 4:112233577-112233599 AATTCTAACTCCAAGAAAGTTGG + Intronic
982492443 4:156046002-156046024 GATTCTAACTACCAGGGGGCCGG + Intergenic
996101963 5:119453165-119453187 CATACAAACTCCAACGGGGAAGG - Intronic
996285892 5:121792077-121792099 GGTTCTTACTGCAAGGGGGTAGG - Intergenic
999696039 5:154189929-154189951 CATTCTAACTCCAAGGGGGTTGG + Intronic
1005732423 6:28710821-28710843 CATTTTAATTCCAAGGGCCTTGG - Intergenic
1007375835 6:41456170-41456192 CATAGTAGGTCCAAGGGGGTTGG - Intergenic
1009978030 6:70694066-70694088 CATTTGAACTTCAAGAGGGTTGG - Intronic
1011389817 6:86839305-86839327 CCACCTAACTGCAAGGGGGTGGG - Intergenic
1014813189 6:125907636-125907658 AATGCTAAGTCCAAGGAGGTGGG - Intronic
1015198282 6:130548632-130548654 CAATCTAAATACAGGGGGGTAGG + Intergenic
1018766896 6:166941009-166941031 CTGACTAACTCCATGGGGGTTGG - Intronic
1019425725 7:975663-975685 CTTGCTGACTCCGAGGGGGTGGG - Intergenic
1022574963 7:31488739-31488761 CATACTAACTCCAAGGAGCCCGG + Intergenic
1022609800 7:31858401-31858423 CATTCTCACTCCAAGGGCCTAGG - Intronic
1023319719 7:38981116-38981138 CATCCTACCTTCAAGGGGTTAGG - Intronic
1032139869 7:129318510-129318532 CATTTTAAATCCATGGTGGTGGG + Intronic
1036098116 8:5747389-5747411 TACTCTAACTGCAAGGGGTTGGG - Intergenic
1036609689 8:10339158-10339180 CATTCCAAAGCCAAGGGGCTAGG - Intronic
1037448340 8:18990577-18990599 CATTCTCACTCCATGTGGTTTGG + Intronic
1038381564 8:27099746-27099768 CATGTTAACTCCATGAGGGTAGG + Intergenic
1042455423 8:68996617-68996639 CCTTCTAAATCCAAGGGAATGGG + Intergenic
1046313759 8:112473767-112473789 CATTCTGACTCCAAGGGTGAAGG - Intronic
1047033580 8:120910968-120910990 CAGTCTATCTTCAAGTGGGTGGG - Intergenic
1047092116 8:121586062-121586084 CCATCTAAATCTAAGGGGGTGGG + Intergenic
1048709138 8:137188195-137188217 CATTTTAACTCCATGGTGGGAGG + Intergenic
1050861962 9:10446126-10446148 CTTTCTATTTCAAAGGGGGTGGG - Intronic
1054878769 9:70123595-70123617 CATTCTAAGTCCTGGGGGTTAGG - Intronic
1062054469 9:134463733-134463755 CATTGCAGCTCCAAGGGGGCAGG - Intergenic
1192167080 X:68833016-68833038 CATTCTGACTCCCTGGAGGTGGG - Intronic
1196731539 X:118945959-118945981 CATTCTAACTCCCAGGATGATGG + Intergenic
1197518739 X:127471809-127471831 TAGTCAAACTCCAAGGGGGTAGG - Intergenic