ID: 999697867

View in Genome Browser
Species Human (GRCh38)
Location 5:154202339-154202361
Sequence CACAGCTCGGTGTGGTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999697852_999697867 30 Left 999697852 5:154202286-154202308 CCTTGGAGGCTCCAGGTGGCTCC 0: 1
1: 0
2: 5
3: 38
4: 305
Right 999697867 5:154202339-154202361 CACAGCTCGGTGTGGTGGCCAGG No data
999697859_999697867 9 Left 999697859 5:154202307-154202329 CCTGGTGTGGCAGTGGGGCATGG 0: 1
1: 0
2: 1
3: 43
4: 351
Right 999697867 5:154202339-154202361 CACAGCTCGGTGTGGTGGCCAGG No data
999697855_999697867 19 Left 999697855 5:154202297-154202319 CCAGGTGGCTCCTGGTGTGGCAG 0: 1
1: 0
2: 1
3: 26
4: 278
Right 999697867 5:154202339-154202361 CACAGCTCGGTGTGGTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999697867 Original CRISPR CACAGCTCGGTGTGGTGGCC AGG Intronic
No off target data available for this crispr