ID: 999698306

View in Genome Browser
Species Human (GRCh38)
Location 5:154205492-154205514
Sequence CTGCAGTCCTTGGGAAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 6, 3: 30, 4: 227}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999698306_999698310 -8 Left 999698306 5:154205492-154205514 CCAGGCTTTCCCAAGGACTGCAG 0: 1
1: 0
2: 6
3: 30
4: 227
Right 999698310 5:154205507-154205529 GACTGCAGCTCCCAGTAAGTGGG 0: 1
1: 0
2: 0
3: 19
4: 164
999698306_999698309 -9 Left 999698306 5:154205492-154205514 CCAGGCTTTCCCAAGGACTGCAG 0: 1
1: 0
2: 6
3: 30
4: 227
Right 999698309 5:154205506-154205528 GGACTGCAGCTCCCAGTAAGTGG 0: 1
1: 1
2: 2
3: 10
4: 176
999698306_999698312 0 Left 999698306 5:154205492-154205514 CCAGGCTTTCCCAAGGACTGCAG 0: 1
1: 0
2: 6
3: 30
4: 227
Right 999698312 5:154205515-154205537 CTCCCAGTAAGTGGGTAAATGGG 0: 1
1: 0
2: 3
3: 9
4: 120
999698306_999698311 -1 Left 999698306 5:154205492-154205514 CCAGGCTTTCCCAAGGACTGCAG 0: 1
1: 0
2: 6
3: 30
4: 227
Right 999698311 5:154205514-154205536 GCTCCCAGTAAGTGGGTAAATGG 0: 1
1: 0
2: 0
3: 12
4: 103
999698306_999698316 8 Left 999698306 5:154205492-154205514 CCAGGCTTTCCCAAGGACTGCAG 0: 1
1: 0
2: 6
3: 30
4: 227
Right 999698316 5:154205523-154205545 AAGTGGGTAAATGGGCTCATGGG 0: 1
1: 0
2: 0
3: 7
4: 168
999698306_999698315 7 Left 999698306 5:154205492-154205514 CCAGGCTTTCCCAAGGACTGCAG 0: 1
1: 0
2: 6
3: 30
4: 227
Right 999698315 5:154205522-154205544 TAAGTGGGTAAATGGGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999698306 Original CRISPR CTGCAGTCCTTGGGAAAGCC TGG (reversed) Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900933536 1:5751368-5751390 CAGCAGTCCATGAGAAAGCGCGG + Intergenic
901155749 1:7136970-7136992 CTGAAGGCCAGGGGAAAGCCAGG - Intronic
902146119 1:14400587-14400609 TTGCAGTCCCTGGCATAGCCTGG - Intergenic
902621912 1:17655789-17655811 ATGGGGTCCTTGGGAAAGCAGGG + Intronic
903503438 1:23815307-23815329 CAGCAGTCCTTGGCATTGCCTGG - Intronic
904279550 1:29409306-29409328 CTGGAGTCATTGGCACAGCCAGG + Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
911883043 1:103265863-103265885 CTGCAGTCATTGAGGAAGTCAGG - Intergenic
914376998 1:147080469-147080491 CAGCTGTCCTTGGGACAGCAAGG + Intergenic
914474748 1:148013836-148013858 CAGCCGTCCTTGGGACAGCAAGG - Intergenic
915297502 1:154931560-154931582 CTGCACTGCATGGGAAAGACAGG - Intronic
916171087 1:162002238-162002260 CTGGAGTCCTGGGGAGAGCAGGG - Intronic
916808208 1:168280786-168280808 CGGCAGCCAATGGGAAAGCCAGG + Intergenic
917538157 1:175889347-175889369 CTGCAGACCTCGGGGAAGCGTGG + Intergenic
919546681 1:198930458-198930480 CAGCAATCCTTGAGAAACCCAGG - Intergenic
920748693 1:208653427-208653449 CTGAACTCCTTGGGAAAGAATGG - Intergenic
921381761 1:214532140-214532162 CTGAGGTCGTTGGCAAAGCCTGG + Intronic
921502990 1:215929525-215929547 CTGCAGTCTATGTGAAAGACAGG + Intronic
922471890 1:225882093-225882115 CTGCGCTCCTTGGGAATTCCTGG - Intronic
922515984 1:226208722-226208744 TTGGAGACCATGGGAAAGCCAGG - Intergenic
1063445892 10:6116612-6116634 ATGCAGTATTTGGGAAAGCAAGG - Exonic
1065052598 10:21811053-21811075 CTGCATTCCTGGGGAAAGTAGGG - Intronic
1066366430 10:34781303-34781325 ATGCAGTCCTTGGAAGAGCTGGG + Intronic
1067077212 10:43194970-43194992 CTGAAGACATTGGGAAAGGCTGG - Exonic
1067297225 10:44981866-44981888 CTGCAGACCTAGGGAAACCGAGG + Intronic
1068868383 10:61918409-61918431 CTGCAGACCTAGGATAAGCCAGG - Intronic
1069806819 10:71131540-71131562 CTGGAGTCCTTGGGAGATCTAGG - Intergenic
1069866782 10:71508935-71508957 CTTCAGTCCTGGGCAAAGCAGGG + Intronic
1071480585 10:86062038-86062060 CTGCAGACTGTGGGAAAGCCAGG - Intronic
1073180983 10:101583037-101583059 CAGCAGGACTTGGGAAAGGCAGG + Intronic
1076988250 11:254877-254899 CTGCAGTCTTCCGAAAAGCCAGG + Intergenic
1080230101 11:30011284-30011306 CTGCAGGCCTTTGGAGTGCCTGG + Exonic
1080787215 11:35486567-35486589 CTGCTGTCCTTGAGAAAGCCTGG + Intronic
1084617537 11:70246462-70246484 CTGCGGCCCGTGGGAAAGCTGGG + Intergenic
1085235400 11:75010597-75010619 CTGTGATCCTTGGGAAAGCCAGG - Exonic
1085508443 11:77073301-77073323 CTGCAGGCCTTGGGCAGGACAGG - Intronic
1085593773 11:77789944-77789966 CTGCAGGCCTTGGGAGTGGCTGG + Intronic
1087059020 11:93960453-93960475 CTGCAGTCATTTGAAGAGCCAGG + Intergenic
1087236732 11:95727693-95727715 CTTCAATCCTGGGGAAAGCAGGG + Intergenic
1089557051 11:119320601-119320623 CTGCGGTCCCTGGGAAAGCCAGG - Intronic
1089595139 11:119573814-119573836 CTGCAGGCCCTGGGAAATGCAGG + Intergenic
1089979707 11:122762192-122762214 CTGTTGTCCTTGGGTAAGACAGG + Intronic
1090642526 11:128741508-128741530 CTGGAGTCCTCTGGAAAGGCGGG - Intronic
1091194296 11:133718356-133718378 CTGCTGGGCTTGAGAAAGCCTGG - Intergenic
1091896553 12:4109819-4109841 CCACAGGCCTTGGGAAGGCCAGG + Intergenic
1092080100 12:5708944-5708966 TTACAGTCCATGGGAAAGACTGG - Intronic
1092371129 12:7917239-7917261 GTGCAGTCCCTGGGCAAGCAGGG - Intergenic
1092669931 12:10851459-10851481 CTGCAGTCCTGGTGGAAGGCAGG + Intronic
1095899530 12:47313674-47313696 CTGAAGACCTTGGGAAAGAATGG - Intergenic
1096509199 12:52118109-52118131 CTGGAACCCTTGGGGAAGCCGGG + Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098214408 12:68200399-68200421 CCCCAGTCCTTGGCAAAGCCAGG + Intergenic
1098571014 12:71987336-71987358 CTGCAGTGCTTAAAAAAGCCTGG - Intronic
1099146210 12:79045798-79045820 CTGCATCCCTTTGGGAAGCCTGG + Intronic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1101251466 12:102939849-102939871 CTGCAGCCCTGGGGCAAGCTTGG - Intronic
1101317820 12:103645395-103645417 CTGCAATCCTTAGGAAAGAAAGG + Intronic
1101933684 12:109037750-109037772 CGGCACTCCTTGGCAAAGACTGG - Intronic
1102256502 12:111418482-111418504 CTGCGGGCCTTGGGCAGGCCAGG - Exonic
1105241890 13:18615377-18615399 GTGCAGTCATTTGGAAAGTCAGG + Intergenic
1105946773 13:25197034-25197056 TGCCAGTTCTTGGGAAAGCCTGG - Intergenic
1106135237 13:26968623-26968645 CTGCAGTCCTTGGGGACTCCTGG - Intergenic
1111815778 13:93150518-93150540 CAGCAGTCCTTTGGGAAGCTGGG + Intergenic
1113121162 13:106924942-106924964 CTGCAGTCCTTGGCCACCCCAGG - Intergenic
1116546250 14:46168515-46168537 CTGCAGTCTTTTGGCCAGCCTGG - Intergenic
1118315989 14:64726499-64726521 CTGCAGCCTTTGGGAAGGACAGG - Intronic
1119803551 14:77466769-77466791 ATGCAGTCTTTGGCATAGCCAGG - Intronic
1121267525 14:92614018-92614040 CTGCCCTGCTTGGGAAAGCCAGG - Intronic
1125878297 15:43168778-43168800 CTGCAGTCCTTGGGCAAATCTGG - Intronic
1126238155 15:46409737-46409759 CTGAAGACCTTGGGAAACACAGG - Intergenic
1127487442 15:59432404-59432426 GTGCTGTCCTTGGGGAAGACAGG + Intronic
1127739670 15:61890278-61890300 CTGCAGTGCTTTGGAAACCAAGG + Exonic
1127881377 15:63161460-63161482 CTACAGTTCTTTGGAAAGCCAGG - Intergenic
1127881470 15:63162039-63162061 CTTCAGTCCAGGGGAAAGCTGGG - Intergenic
1128741337 15:70085870-70085892 CAGAAGTCCTGGGGAAAGACAGG - Intronic
1130926981 15:88392871-88392893 CTGCAGTGCCTTGGCAAGCCTGG + Intergenic
1135053050 16:19207782-19207804 CTGTAATCCTTGGGGAGGCCAGG + Intronic
1135586968 16:23678973-23678995 CGGCCGACCCTGGGAAAGCCGGG + Exonic
1135992677 16:27227472-27227494 CTGAAATCCCTGGGAGAGCCCGG + Intronic
1137670387 16:50275009-50275031 CTGCATTCCATGGGAGAGGCAGG + Intronic
1138553546 16:57759718-57759740 CTGCAGCCCTCGGGTGAGCCTGG - Exonic
1140722019 16:77780633-77780655 CTGCAGTGCTTGGAAGAGGCAGG + Intergenic
1144553443 17:16261208-16261230 CTGCAGCCCTTTGGAGAGCCCGG + Intronic
1144865379 17:18332299-18332321 CGGCAGTGCCTGGGAAGGCCGGG - Intronic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1145311755 17:21704684-21704706 CTGCAGTCCCTGGGCAAGCAGGG + Intergenic
1147254692 17:39174799-39174821 CTGCAGTACTGGGGAAGGGCTGG - Exonic
1148047054 17:44750699-44750721 CTGGAGCCCTTGGGCAAGGCCGG - Exonic
1150763384 17:67983251-67983273 CTGCTGTCCTGGAGAAATCCAGG - Intronic
1152167827 17:78722421-78722443 CTTCACTCCCAGGGAAAGCCTGG + Intronic
1153967162 18:10192389-10192411 TGGCAGTCCTTGAGCAAGCCTGG - Intergenic
1154447061 18:14444501-14444523 GTGCAGTCATTCGGAAAGTCAGG - Intergenic
1154999183 18:21670027-21670049 CTCAAGTCCTTGGGATAGTCTGG + Intronic
1155195686 18:23471902-23471924 CTGAAGTTCTAGGGAAAGTCAGG + Intronic
1160534468 18:79584817-79584839 CTGCAGGCCTTGGGGAGGCTTGG + Intergenic
1160859730 19:1232627-1232649 CTGCAGGCCTTGGGTCAGGCAGG - Intronic
1160874659 19:1291438-1291460 CTTCCGTCCCTGGAAAAGCCAGG + Intronic
1162342986 19:10102920-10102942 CTGCAGGCCCTGGGGCAGCCAGG + Intergenic
1166416162 19:42596092-42596114 CTGCTGTCCTTCGTGAAGCCAGG - Intronic
1167491988 19:49798404-49798426 CACCAGTCCTTGGGAAGGCCTGG + Intronic
1168423065 19:56217724-56217746 CTGCAGTCCTTGGGGAAGCGGGG + Intergenic
925172549 2:1759354-1759376 CTGCACCCGTTGGGAAAGCTTGG + Intergenic
925276393 2:2651205-2651227 CTGCAGGCCATGGGAAGCCCGGG - Intergenic
925979823 2:9167568-9167590 CTGCATTCCTTGTGAAAGCAAGG + Intergenic
926761942 2:16285785-16285807 CTGCAGTCCCTGGGCAGGTCAGG + Intergenic
927172643 2:20382936-20382958 CTGCAGCCAGTGGGAAAACCTGG + Intergenic
927850074 2:26493390-26493412 CTGCCTTACTTGGGACAGCCTGG + Intronic
929938417 2:46311833-46311855 CCCAAGGCCTTGGGAAAGCCTGG + Intronic
930046916 2:47180640-47180662 CTCCAGTCCTAGGCAAATCCAGG - Intergenic
931424079 2:62154913-62154935 CTGGAGCCTTTGGGAAAGCATGG - Intergenic
933309632 2:80644152-80644174 CTGCAGTCATTGGCAAAGTAGGG - Intronic
934571085 2:95373868-95373890 CTCCATTCCTGGGGAAAGTCAGG + Intronic
935702462 2:105824434-105824456 CAGAAGTACTTGGGAAAGGCAGG + Intronic
936559336 2:113523128-113523150 ATGCAGTCCCTGGAAAAGTCTGG - Intergenic
937031341 2:118743582-118743604 ATGCAGTCCTTGGGTCAGCCTGG + Intergenic
937047879 2:118861798-118861820 CTTAAGTCCTGGGGAAGGCCTGG - Intergenic
937873332 2:126802223-126802245 CTGCCTTCTTTGGGAAACCCAGG + Intergenic
938723549 2:134087181-134087203 CTACGGCCCTTTGGAAAGCCTGG + Intergenic
939086540 2:137726033-137726055 CTGCAACTCTGGGGAAAGCCCGG - Intergenic
939881390 2:147635471-147635493 CTGCATTCCATGGGATGGCCTGG - Intergenic
940196704 2:151103257-151103279 CTGCAGAACTTGGGAAATCAAGG + Intergenic
941459436 2:165751065-165751087 CTTCAGTCTATGGGGAAGCCAGG - Intronic
943284781 2:185983694-185983716 CTTTAGCCCTTGGGAAAGTCTGG + Intergenic
943446436 2:187993592-187993614 CTGCTGTCTTTGGGACAGCAGGG - Intergenic
943932242 2:193868695-193868717 CTGCAGCCCTTCGGGAGGCCAGG + Intergenic
947182634 2:227425744-227425766 CTGTAGTCCATGTGAAAGCAAGG + Intergenic
947593176 2:231396251-231396273 CTCCATTCGTAGGGAAAGCCCGG - Intronic
947808365 2:232983579-232983601 CTGCAGCCTTAAGGAAAGCCAGG - Intronic
948407984 2:237737046-237737068 GTGCAGGCCTGGGGGAAGCCTGG - Intronic
1172630328 20:36374203-36374225 CTGCAGTCATTTGGAGGGCCAGG - Intronic
1174772162 20:53310533-53310555 CTGCAGCCCTGGCCAAAGCCTGG - Intronic
1175951211 20:62584374-62584396 CAGCAGTTCTGGGGACAGCCTGG - Intergenic
1176035455 20:63034103-63034125 CTGCAGGCTCTGGGACAGCCTGG + Intergenic
1177009607 21:15716095-15716117 CTGCAGTCCTTGGGGATGTATGG + Intergenic
1177682478 21:24390603-24390625 CTGGAGTCCTTGGAAATGGCAGG - Intergenic
1178576677 21:33798796-33798818 ATGCAGTCCAGGGGAAAGACTGG + Intronic
1179375239 21:40844918-40844940 CTGAACTCCTTGGAAAGGCCTGG - Intronic
1179905136 21:44418746-44418768 CTGCGGTCCTTAGGAAGGCTGGG + Intronic
1183175966 22:36224983-36225005 TTGCAGTCCATTGGAAGGCCAGG + Intergenic
1183856038 22:40636066-40636088 GTGCAGTCCTTGGGATTCCCAGG - Intronic
1184043717 22:41959062-41959084 CTGCAGCTCTTGGGAAGCCCTGG - Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
950854428 3:16091921-16091943 CTGCACTCTTTGAGAAAGCAGGG - Intergenic
951495431 3:23320059-23320081 CTCCTGCCCATGGGAAAGCCAGG + Intronic
952389571 3:32868516-32868538 ATGCAGCCATTCGGAAAGCCAGG + Intronic
952769882 3:36989676-36989698 CTGCAGTGCATGGGACAGCCTGG - Exonic
954106234 3:48411181-48411203 CTGCTGTCCCTGGGGAAGGCAGG - Intronic
954601687 3:51875361-51875383 TTGAAGTCCTAGAGAAAGCCAGG - Intronic
956678806 3:71759129-71759151 CTGTAGGCCTTGGGAAAACAGGG - Intergenic
960088750 3:113617427-113617449 CTGCAGCACTTTGTAAAGCCTGG - Intronic
961222558 3:125212271-125212293 CTGCAGTCCTGCCAAAAGCCGGG + Intronic
961647807 3:128401716-128401738 GAGCAATCCTTGGGATAGCCAGG + Intronic
961954907 3:130791428-130791450 ATGCACTCATTGGGCAAGCCAGG + Intergenic
962267365 3:133953504-133953526 CTGCAGTCCCTCGGAGAGCCAGG - Intronic
963330013 3:143903734-143903756 CTGAAGTTCTTGGCAAAGCATGG - Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
967819378 3:193826764-193826786 CTACAGTCCTTGGGAATGGGTGG + Intergenic
968661074 4:1799045-1799067 CCGGAGTCCTTGGGACAGACTGG + Intronic
968770567 4:2503327-2503349 CTGCAGTCATTGGGAGACCCGGG + Intronic
969843142 4:9898538-9898560 CTGTAGTCCCTGAGAAAGTCAGG - Intronic
970755969 4:19427689-19427711 CTGCAGACCTGGGGAAAGCAGGG - Intergenic
971274406 4:25182326-25182348 ATGCAGACATTAGGAAAGCCTGG + Intronic
972687094 4:41361573-41361595 CTGCAGTCCTTGGGATGGAGAGG - Intronic
973651155 4:52998154-52998176 CTGCAGTCATTGGCAAGGCCTGG + Intronic
974193647 4:58540619-58540641 CTATTATCCTTGGGAAAGCCTGG + Intergenic
975542309 4:75526737-75526759 CTGCAGTCTTTGTGTATGCCTGG + Intronic
975912973 4:79290617-79290639 CTGGAGTCCTGGGCAATGCCTGG - Intronic
976161223 4:82201496-82201518 CTGCAGTCCATGGGCAAGTCTGG + Intergenic
976638684 4:87313889-87313911 CTTCAGGCCTTGGGAAAAACTGG - Exonic
977269958 4:94905658-94905680 CTGCATTCCTTTGCATAGCCTGG + Intronic
978021536 4:103819536-103819558 CTGCTTTCCTTGGGAATGGCAGG + Intergenic
979612112 4:122700343-122700365 GTGCTGTCCGTGGGAAGGCCTGG - Intergenic
982026540 4:151257933-151257955 AGCCAGTCCTTGGGAGAGCCAGG + Intronic
982798080 4:159669034-159669056 CTACAGTCTTTGGGCAATCCTGG - Intergenic
983667848 4:170202183-170202205 CTGGAGTCCTTGGGCAGGCTGGG - Intergenic
986153151 5:5146327-5146349 GTGCAGACGTTGGGAAAGACAGG + Exonic
990669832 5:58115630-58115652 CTGGAGTTCCTGGGAAAGTCTGG - Intergenic
993189272 5:84660532-84660554 CTGGAGCCCTAGAGAAAGCCAGG - Intergenic
996397699 5:123030029-123030051 TTGCTGTCCTTTGGAAAGCTGGG - Intronic
997585507 5:135040762-135040784 CTCCAGTCCCTGAGAAAGGCAGG - Intronic
997992246 5:138554301-138554323 CTGGAGTACTTTGGAAATCCTGG + Intergenic
999698306 5:154205492-154205514 CTGCAGTCCTTGGGAAAGCCTGG - Intronic
1003248292 6:4402379-4402401 GTGGAGTCCTTGGGGGAGCCTGG - Intergenic
1003253638 6:4455548-4455570 CTGCTGTGCTTGGGAAACCCTGG - Intergenic
1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG + Intronic
1004427731 6:15517528-15517550 GTGCAGCCCTTGGGAAAGCCGGG - Intronic
1004576972 6:16905908-16905930 TTGCAAGCCGTGGGAAAGCCTGG + Intergenic
1004671180 6:17798672-17798694 CAGCAGTCCTTGTGAAAGCCAGG + Intronic
1005857176 6:29871523-29871545 CTGTAGTCCTTGGCAAAACAAGG + Intergenic
1006384765 6:33724314-33724336 CAGATGTCCTTTGGAAAGCCGGG - Intronic
1007525314 6:42487350-42487372 CGGCAGTCCTAGGGAGAGTCTGG - Intergenic
1008686400 6:53930310-53930332 CAGCAGTCCTTGGGAAACCCAGG + Intronic
1010141424 6:72619493-72619515 CTGCAACCATTGGGAAAGACTGG - Intergenic
1010198766 6:73264628-73264650 GTGCATTCCTTTGGCAAGCCTGG + Intronic
1010445068 6:75940259-75940281 CTGGAGGCCAAGGGAAAGCCAGG - Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1016908512 6:149174441-149174463 CTGCAGCCCATGGAAAAGCCTGG + Intergenic
1017023959 6:150165440-150165462 CTAAAGTCCTTGGGGAAGGCTGG + Intronic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1019119379 6:169791014-169791036 CTGGAGTCCCTAGGAAATCCAGG - Intergenic
1019526059 7:1481034-1481056 CTGAAGTCCTTGGGAAGTGCTGG - Intronic
1021528619 7:21617973-21617995 CTGCTGTCCTGGGGACAGCCTGG - Intronic
1023165011 7:37335250-37335272 CTGCAGTGCTTAGCAAAGCCAGG + Intronic
1023390794 7:39709873-39709895 CTGCAGCCCTGGGGAAATCTCGG - Intergenic
1024090425 7:45935234-45935256 CTGCATTCCATGGGAAAGACAGG + Intergenic
1024294713 7:47833019-47833041 CTGCAGCCATTGGGAGAGGCAGG - Intronic
1025233600 7:57219038-57219060 CTGGAGACCTTGGGAGAGGCTGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026329137 7:69336902-69336924 CTGCATTCCCTGGGAATTCCAGG + Intergenic
1026359741 7:69591983-69592005 CTGCAGCTCTTGGGGGAGCCGGG - Intergenic
1026902822 7:74046437-74046459 CTGCAGCCCTTGGCACAGGCTGG - Intronic
1028033562 7:85950016-85950038 CTACAGTCCTTGGGCAAGTATGG - Intergenic
1029310695 7:99660850-99660872 ATGTAGACCTTGGGAAAACCTGG - Intronic
1029715659 7:102324079-102324101 CTGCATCCCTTGGGAGAGCCCGG - Intergenic
1031679247 7:124650899-124650921 GTGCAGTCCTGGGCAAGGCCAGG + Intergenic
1031852909 7:126887392-126887414 CTGTGGTCCTTGAGAAATCCTGG + Intronic
1034190462 7:149209456-149209478 CTGCAGTCCTTGATGAAGACAGG - Intronic
1036396846 8:8377474-8377496 CAGCACTCCTTGGGGAAGCTCGG + Exonic
1036570560 8:9976590-9976612 CTGCAGTCCCTGTGAAACCTGGG + Intergenic
1036708485 8:11062047-11062069 CTGCATTCCATGGGACAGACAGG + Intronic
1036816814 8:11908535-11908557 CTTGAGCCCTTGGGGAAGCCGGG + Intergenic
1037604495 8:20425864-20425886 CTGCAGTGCTGTGGAAAGTCTGG + Intergenic
1037900217 8:22683872-22683894 CTGCAGGCCCTGGGCAGGCCTGG + Intergenic
1040436749 8:47398657-47398679 CTGCAGTCCACGGGCAGGCCTGG + Intronic
1041303458 8:56436931-56436953 CAGCAGGACTTGTGAAAGCCTGG - Intronic
1041830211 8:62144727-62144749 CGGCCGTCCCTGGGAAAGCCGGG - Intergenic
1042022179 8:64379584-64379606 CTGCAGTCCTGGGCCAAGCTGGG + Intergenic
1042165256 8:65938946-65938968 CTGAAGTGCATGGGAAACCCAGG - Intergenic
1042346052 8:67729149-67729171 CTGCAGTCCCAGGTAGAGCCTGG - Intronic
1044529807 8:93294162-93294184 CAGCAAGCCTTGGGAAAGCCAGG - Intergenic
1045126623 8:99098237-99098259 CTTCAGTCACTGGGAAAGACAGG + Intronic
1045239259 8:100384602-100384624 CTGCAGAGCCTGGGGAAGCCTGG - Intronic
1045424950 8:102056577-102056599 CTCTAGTCCATGGGACAGCCTGG - Intronic
1047536143 8:125721542-125721564 CTGAAATCCTTGGGGCAGCCTGG + Intergenic
1049521287 8:143092722-143092744 CTGCAGTGCCCAGGAAAGCCTGG + Intergenic
1049893519 9:93069-93091 ATGCAGTCCCTGGAAAAGTCTGG + Intergenic
1050489683 9:6175161-6175183 CTGGAGGCCTTTGGTAAGCCAGG + Intergenic
1051469679 9:17423610-17423632 CTGCGGTCCTTGGGCAAGTCTGG - Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052669833 9:31541770-31541792 CTGCCATCCTGGGGAAAGCATGG - Intergenic
1053064483 9:35058038-35058060 TTGCAATCATTGGGAAACCCTGG - Intronic
1053173371 9:35906376-35906398 CTGCCGTCCGTGGAAAAGGCAGG - Exonic
1054693643 9:68338260-68338282 ATGCAGTCCCTGGAAAAGTCTGG - Intronic
1055727132 9:79242606-79242628 CTACTGTGCATGGGAAAGCCAGG + Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056406603 9:86281926-86281948 CAGCGGTCCTTCGGACAGCCTGG + Intronic
1057081275 9:92176343-92176365 CTGCAGACTTGGGGAAAGCAGGG + Intergenic
1057857993 9:98617004-98617026 ATGCAGTACCTGGGGAAGCCTGG - Intronic
1058011424 9:99981622-99981644 CTGCAGGCCTGGGGAAATCAGGG + Exonic
1058641142 9:107086693-107086715 CTGCAGTACTTGGCAACCCCAGG + Intergenic
1059437272 9:114284372-114284394 CTGCAGGCCTAGCCAAAGCCTGG + Intronic
1060186808 9:121568601-121568623 ATGCGGTCCTTGGGGAGGCCAGG + Intronic
1185557765 X:1034847-1034869 CTGCAGTCCCCGGGAAAGGCAGG + Intergenic
1192494620 X:71607166-71607188 CTGCAGACTTTGGCAGAGCCCGG - Intronic
1194950572 X:100121113-100121135 CTGCAGCTCTAGGGAAAGGCTGG - Intergenic
1195068402 X:101257710-101257732 CTGCAGGCCCTGGGAAACACTGG + Intronic
1195083479 X:101392072-101392094 CTTCAGTTCTTAGGAAAGCAGGG - Intronic
1195432005 X:104799386-104799408 CTGGAGGCCTTGTGAAAACCTGG + Intronic
1197826280 X:130593860-130593882 ATGTAGTCCTTAGGAAAGGCTGG - Intergenic
1199613879 X:149639946-149639968 CTGCAGTCCTTAGGAAACACAGG + Intergenic
1199627888 X:149757702-149757724 CTGCAGTCCTTAGGAAACACAGG + Intergenic
1199868459 X:151875323-151875345 CTGCTGTTCTTGGGCAAGCAAGG - Intergenic