ID: 999710803

View in Genome Browser
Species Human (GRCh38)
Location 5:154316622-154316644
Sequence TGGGATACACAGTCTAATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999710803_999710810 21 Left 999710803 5:154316622-154316644 CCCTGATTAGACTGTGTATCCCA 0: 1
1: 0
2: 0
3: 8
4: 103
Right 999710810 5:154316666-154316688 TTTCCTGCCATTTTAATTCCAGG 0: 1
1: 0
2: 2
3: 32
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999710803 Original CRISPR TGGGATACACAGTCTAATCA GGG (reversed) Intronic
907929993 1:58990486-58990508 TGGTATAGACAGTCGAATAATGG - Intergenic
909851310 1:80467745-80467767 TGGGAGACACATTCAAACCATGG - Intergenic
910737633 1:90478727-90478749 TGGAATTTACAGTCTAATTAAGG - Intergenic
912520021 1:110238883-110238905 TGGGACTTACATTCTAATCAGGG + Intronic
913997112 1:143660667-143660689 AGGGGTACACAGTCTGATCGGGG + Intergenic
917035751 1:170745353-170745375 TGAGATTCACATTCTAATGAGGG + Intergenic
918545039 1:185672761-185672783 TTGGTTACACAGTGTTATCAGGG - Intergenic
923121217 1:230993578-230993600 TGGACTATACAGTCTAATTAGGG - Intronic
1064207467 10:13336163-13336185 TGGGAAACCAAGTCTAACCAAGG + Intronic
1066200305 10:33137745-33137767 AGGAATTCCCAGTCTAATCAGGG + Intergenic
1067795771 10:49320499-49320521 TGGCACTGACAGTCTAATCATGG + Intronic
1069400138 10:68035616-68035638 TGGGATAAACACTTTAAACAAGG + Intronic
1070400169 10:76046326-76046348 TGGGACCCACTGTCCAATCATGG - Intronic
1071007158 10:80895974-80895996 TGGAATAAACAGTCTAATAAAGG - Intergenic
1071310346 10:84337543-84337565 TGGGATAGACAGTTTCTTCAAGG + Intronic
1072170585 10:92856640-92856662 TAGGATACACAGTCTTCTCAAGG - Intronic
1072568490 10:96638125-96638147 TGGGGCACACATTCAAATCATGG - Intronic
1086567848 11:88246938-88246960 TGAGAAACACAGTCTGATGAGGG - Intergenic
1088801348 11:113310109-113310131 TGGGAAACACAGTCTACTCTAGG + Intergenic
1095433679 12:42164176-42164198 TGACAAATACAGTCTAATCATGG - Intronic
1101380212 12:104207836-104207858 CGGGAGACACAGACTAATGAAGG + Intergenic
1103294679 12:119876303-119876325 TAGGAAGCTCAGTCTAATCATGG + Intronic
1108598845 13:51973329-51973351 TGGGGGACACAGTCAAACCATGG - Intronic
1109306310 13:60645803-60645825 TGTGATTCACAGAGTAATCAAGG - Intergenic
1114876740 14:26729801-26729823 TGGGATACAAAATGTCATCAAGG + Intergenic
1118504131 14:66392068-66392090 TGGCAGACTCAGTCTAGTCAGGG - Intergenic
1128359234 15:66949139-66949161 TGGGAGACACATTCAAACCACGG - Intergenic
1129563831 15:76599492-76599514 TGGAATACACAAACAAATCAAGG + Intronic
1133770039 16:8862578-8862600 GGGAATACACACGCTAATCAGGG + Intronic
1135143184 16:19939141-19939163 TGTGACACACAGTATTATCATGG + Intergenic
1135685683 16:24496696-24496718 AGGGCTAGAAAGTCTAATCAGGG - Intergenic
1138271809 16:55701125-55701147 TGGAGTTCACATTCTAATCAAGG + Intronic
1141017888 16:80467421-80467443 TGGGAGACACAGTTTAGCCAGGG - Intergenic
1144005486 17:11095599-11095621 TGGGTCACACAGTCCATTCATGG + Intergenic
1144403059 17:14925435-14925457 TGAAATACACATTCTAGTCATGG + Intergenic
1155319014 18:24600064-24600086 AGGGATACATATTCTAAGCATGG + Intergenic
1156784830 18:40898047-40898069 TGGGAGACTCAGTCTTTTCATGG - Intergenic
1163293907 19:16399602-16399624 TGGTGTAAACAGTCTCATCATGG + Intronic
1165906978 19:39200151-39200173 TGGGATTCACAGTCCAGTGAGGG - Intronic
926476977 2:13335956-13335978 TGGGATTCATAGTCTAGTAAAGG + Intergenic
927692775 2:25219855-25219877 TGGGACACATACTCTACTCATGG - Intergenic
930932720 2:56907062-56907084 TGGGATATGGAGTCTAATCTGGG - Intergenic
935364390 2:102274211-102274233 CAGGATCCAAAGTCTAATCAAGG - Intergenic
936651802 2:114436251-114436273 TGGGATGCACAGTAGAATCCAGG + Intergenic
939028780 2:137045781-137045803 TGGGGTACCCAGTCTTCTCAAGG - Intronic
941408281 2:165119615-165119637 TGGCATTCACATTCTAGTCAAGG + Intronic
943762505 2:191625115-191625137 TGGGTTATACAGTCCCATCAGGG + Intergenic
1169432056 20:5545394-5545416 TGTGATGCACAGCCTGATCAAGG + Exonic
1170072932 20:12388675-12388697 TGGCATGAACAGTTTAATCATGG + Intergenic
1171414352 20:24967569-24967591 TGGTATGCACATTCTATTCAGGG + Intronic
1173284844 20:41660959-41660981 TGGGGTAGACAGTCTTATAAGGG - Intergenic
1181575980 22:23795211-23795233 TGGGCAACACAGTCAAATCGTGG - Intronic
1183875810 22:40780166-40780188 TAGGAAATACAGTCTAACCAAGG + Intronic
957868970 3:86063346-86063368 TGGTATACACAGGGTAATCAGGG + Intronic
960885660 3:122391579-122391601 TGGGAGATACAGTCTGATCTAGG + Intronic
961339738 3:126209959-126209981 TGGGATACACAGCCAAACCCGGG - Intergenic
964102281 3:153001496-153001518 TGGGGGACACAGTCAAACCATGG + Intergenic
966985036 3:185172368-185172390 AGGAATTTACAGTCTAATCAAGG - Intergenic
967816978 3:193807972-193807994 CAGGATACATAGTCTAATGAAGG + Intergenic
972230545 4:37067872-37067894 TAGTATGCACAGTCTAAACAAGG + Intergenic
972634599 4:40871869-40871891 AGGAATTCACAGTCTAACCAGGG + Intronic
976699470 4:87953403-87953425 TGAGACACTAAGTCTAATCAGGG - Intergenic
977801262 4:101235552-101235574 TGGAATTCATAGTCTAATGAGGG - Intronic
980062507 4:128146999-128147021 TGGGATAGACACTGTCATCAAGG - Intronic
980166972 4:129240856-129240878 TGGGAAACAGAGTCTAGTCTTGG + Intergenic
980764286 4:137279385-137279407 TGGTAATCTCAGTCTAATCATGG + Intergenic
980931279 4:139185418-139185440 TGGTATTCACATTTTAATCATGG - Intergenic
982363551 4:154550305-154550327 TGGGATACACGGTAGCATCATGG - Exonic
983823285 4:172224719-172224741 TGTGATACACAGTCTTCACAGGG - Intronic
984948074 4:184985419-184985441 TTGGACACAGAGTCTAACCAAGG + Intergenic
988382345 5:30514188-30514210 TGGCTTACAGAGTCTAAGCAGGG - Intergenic
988493419 5:31724629-31724651 TGGGTTACACAGTATTTTCAGGG - Intronic
993566441 5:89481718-89481740 TGGCAAACACTGGCTAATCATGG - Intergenic
997355567 5:133260645-133260667 TGGGAAACAGAGTCTGATCATGG - Intronic
997652149 5:135530398-135530420 TGGGGTGCACAGTCAAATCACGG - Intergenic
998482801 5:142476945-142476967 TGGGAAATACAGTCTAGTGATGG + Intergenic
999710803 5:154316622-154316644 TGGGATACACAGTCTAATCAGGG - Intronic
1000782892 5:165505938-165505960 TGTTATACCCAGTCTAAACACGG + Intergenic
1001137762 5:169116718-169116740 AGGGAGAAACAGGCTAATCAGGG + Intronic
1001559025 5:172657295-172657317 TGGGATGGAGATTCTAATCAGGG + Intronic
1010891622 6:81319719-81319741 TGGGAGACACATTCAGATCATGG - Intergenic
1012970648 6:105726730-105726752 TGGGCTTCACAGTCAAATCCAGG + Intergenic
1017394772 6:153985051-153985073 TGGAATAAAGAGTCTAACCATGG - Intergenic
1018865719 6:167745736-167745758 TGGGATACACATTTTCTTCAGGG + Intergenic
1020879729 7:13744881-13744903 GAGGGTACACAGTCTAAGCAAGG - Intergenic
1021664878 7:22967170-22967192 AGGGACTCACAATCTAATCATGG + Intronic
1026655297 7:72251285-72251307 TGGGATAGATAGTATAATAAAGG - Intronic
1029333895 7:99883637-99883659 TGGGATGGCCAGCCTAATCACGG - Intronic
1038657906 8:29470900-29470922 GGGGATAAACAGTCAAACCATGG + Intergenic
1039157534 8:34578530-34578552 TCTGATACAGTGTCTAATCAAGG - Intergenic
1040112815 8:43578197-43578219 GGGGATACTCAGTCTTTTCACGG - Intergenic
1043124339 8:76370677-76370699 TGGGATATATAGTCTATTAAGGG - Intergenic
1044359188 8:91261455-91261477 TGGGTTATACAATCTACTCAAGG - Intronic
1046049948 8:109010903-109010925 TGGCATACACAATCAACTCAGGG - Intergenic
1046810707 8:118530264-118530286 TGTGACACACAGTCTACTCATGG - Intronic
1047601548 8:126430571-126430593 TTGGAGACACAGTCTGATCAAGG - Intergenic
1047995909 8:130335688-130335710 TGGGAGACACAGCCTCAGCAGGG - Intronic
1048720379 8:137317489-137317511 TGGAATACACATTCTTTTCAAGG - Intergenic
1050423034 9:5486928-5486950 TGGAATTCACATTCTAATAAGGG + Intergenic
1051435509 9:17026774-17026796 TGGGATATTGTGTCTAATCAAGG + Intergenic
1051949983 9:22620013-22620035 TGGGAAACACATTTAAATCATGG - Intergenic
1057239002 9:93392150-93392172 TGGAATAGACAGCCTCATCAAGG - Intergenic
1057800461 9:98188021-98188043 TGGGGTACACAGTCTAGCCCAGG + Intronic
1059179627 9:112199559-112199581 TTGAGTGCACAGTCTAATCAGGG - Intergenic
1059343985 9:113616050-113616072 TGGGAAGGACAGTCTATTCAAGG - Intergenic
1061214614 9:129214084-129214106 TTTGTTACACAGTCTTATCATGG + Intergenic
1186323491 X:8454340-8454362 TGGTAAACCCAGTCCAATCAAGG + Intergenic
1186582612 X:10836973-10836995 GGGTCTACCCAGTCTAATCATGG - Intergenic
1187506710 X:19884238-19884260 TGGGCTTCTCAGTCTAATGAAGG - Intronic
1194236921 X:91396514-91396536 TGGGCTACATGCTCTAATCATGG - Intergenic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1199998988 X:153047010-153047032 TGGGATCCAATGTCAAATCACGG - Intergenic