ID: 999711158

View in Genome Browser
Species Human (GRCh38)
Location 5:154319790-154319812
Sequence GTGTTTTAGGATCTCAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 136}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999711158_999711163 15 Left 999711158 5:154319790-154319812 CCAGTGTTGAGATCCTAAAACAC 0: 1
1: 0
2: 0
3: 10
4: 136
Right 999711163 5:154319828-154319850 CTTAAGTGGGGCTGCTAAGATGG 0: 1
1: 0
2: 1
3: 5
4: 110
999711158_999711162 3 Left 999711158 5:154319790-154319812 CCAGTGTTGAGATCCTAAAACAC 0: 1
1: 0
2: 0
3: 10
4: 136
Right 999711162 5:154319816-154319838 ATGTAGACAAGTCTTAAGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 140
999711158_999711160 1 Left 999711158 5:154319790-154319812 CCAGTGTTGAGATCCTAAAACAC 0: 1
1: 0
2: 0
3: 10
4: 136
Right 999711160 5:154319814-154319836 ACATGTAGACAAGTCTTAAGTGG No data
999711158_999711165 27 Left 999711158 5:154319790-154319812 CCAGTGTTGAGATCCTAAAACAC 0: 1
1: 0
2: 0
3: 10
4: 136
Right 999711165 5:154319840-154319862 TGCTAAGATGGGAGTGTCACTGG 0: 1
1: 0
2: 4
3: 17
4: 314
999711158_999711161 2 Left 999711158 5:154319790-154319812 CCAGTGTTGAGATCCTAAAACAC 0: 1
1: 0
2: 0
3: 10
4: 136
Right 999711161 5:154319815-154319837 CATGTAGACAAGTCTTAAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 72
999711158_999711164 16 Left 999711158 5:154319790-154319812 CCAGTGTTGAGATCCTAAAACAC 0: 1
1: 0
2: 0
3: 10
4: 136
Right 999711164 5:154319829-154319851 TTAAGTGGGGCTGCTAAGATGGG 0: 1
1: 0
2: 1
3: 12
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999711158 Original CRISPR GTGTTTTAGGATCTCAACAC TGG (reversed) Intronic
901038097 1:6348458-6348480 GGGGGTTAGGATTTCAACACAGG - Intronic
901219074 1:7572735-7572757 GGGGTTTAGGATTTCAACATAGG + Intronic
902217842 1:14945585-14945607 GTGTTTGAGGCTCTCCCCACCGG - Intronic
902329869 1:15725997-15726019 GGGAGTTAGGATTTCAACACAGG + Intronic
903920616 1:26797638-26797660 GTCTTTAAGGATCTCAACAGCGG - Exonic
904715696 1:32465733-32465755 GTGGTTAAGGATGTCAACCCGGG + Intronic
908001690 1:59686628-59686650 GTGTTCTAGGCTCTCAGCCCTGG + Intronic
911191847 1:94956217-94956239 GTGTTTTAGGATGATAACTCTGG + Intergenic
911397578 1:97331225-97331247 GTGTTTTAGGAGGTCAAGACAGG + Intronic
912865758 1:113254920-113254942 GTGTTTTAAAATCTCAATATCGG - Intergenic
915262459 1:154687038-154687060 GTGTTTGAAGATCACACCACTGG + Intergenic
917719271 1:177770616-177770638 GAGATTTAGGATTTGAACACAGG - Intergenic
918708125 1:187694092-187694114 GTGTCTTAGGTTCTCCACCCTGG + Intergenic
919355240 1:196514165-196514187 GTGTTTTCAGAACCCAACACAGG + Intronic
1066062956 10:31740308-31740330 GGGTTTTGGGGTCTGAACACTGG - Intergenic
1068171712 10:53403430-53403452 CAGTTTTTGGTTCTCAACACGGG + Intergenic
1069598466 10:69687783-69687805 GTGATTTAGGATCTCAGCTCTGG + Intronic
1071447065 10:85758427-85758449 GTGGTTTAGGAGCTCATCAGAGG + Intronic
1080631914 11:34085462-34085484 TTATTTTAGGATGTAAACACAGG + Intronic
1082624735 11:55469482-55469504 GTATTTTTGGATTTCATCACAGG + Intergenic
1083436153 11:62644983-62645005 GTGTACTATGATCTCATCACAGG + Intronic
1088049502 11:105494320-105494342 CTGTTTTCGGATCTAAACACTGG - Intergenic
1091810345 12:3391705-3391727 GTCTGTGAGGTTCTCAACACTGG + Intronic
1092523058 12:9292890-9292912 GGGGGTTAGGATTTCAACACAGG + Intergenic
1092544233 12:9439007-9439029 GGGGGTTAGGATTTCAACACAGG - Intergenic
1093920710 12:24856406-24856428 GTGGGTTAGGATTTCAACATAGG - Intronic
1094135931 12:27126153-27126175 GTGTTTTATGATCTTAAAATGGG + Intergenic
1094185476 12:27637900-27637922 GTGTTTTATGATCTTAAAATGGG + Intronic
1094508713 12:31083061-31083083 GGGGGTTAGGATTTCAACACAGG + Intronic
1094848396 12:34371507-34371529 GTGTTTTCGTTCCTCAACACAGG + Intergenic
1098987089 12:77024268-77024290 GTGTGTTAGGATCCCAAGGCAGG + Intronic
1100034396 12:90233934-90233956 GTATTTTAGGGAGTCAACACAGG + Intergenic
1101098812 12:101371428-101371450 TTGGTTGAGGAGCTCAACACAGG + Intronic
1105415620 13:20208954-20208976 GGGGGTTAGGATTTCAACACAGG - Intergenic
1105658622 13:22468850-22468872 GGGGGTTAGGATGTCAACACAGG - Intergenic
1110893959 13:80725883-80725905 TTGTTTTAGCATCTCATAACTGG + Intergenic
1114064258 14:19047486-19047508 CTGTTTAGGCATCTCAACACAGG - Intergenic
1114098001 14:19352512-19352534 CTGTTTAGGCATCTCAACACAGG + Intergenic
1114746795 14:25156879-25156901 GTGTTTTAAGTTCTCAACTGAGG - Intergenic
1115880574 14:37912717-37912739 GTGTTTTATGGTCTGACCACTGG + Intronic
1121419551 14:93803089-93803111 GTGTTCCATGATCTCAACCCAGG + Intergenic
1124036113 15:26054775-26054797 GTGTTTTAGGATCGTAAGTCTGG + Intergenic
1124412098 15:29445091-29445113 GGGTGTTAGGATTTCAACATAGG - Intronic
1130295626 15:82645982-82646004 GTGTTTTGGGGACTCATCACTGG - Intronic
1131909477 15:97181413-97181435 GGGTTTTAGGGTCTCAAATCAGG - Intergenic
1133517343 16:6522255-6522277 GTGCTTTATGATCTCTTCACTGG - Intronic
1134785787 16:16942088-16942110 GTTTTGTATGATCTCAACCCTGG + Intergenic
1140734326 16:77884565-77884587 GGGTTATAGGAACTCAATACCGG - Intronic
1141999161 16:87654289-87654311 GTGTTTCAGGATCTGAAAAAAGG - Intronic
1147020032 17:37523917-37523939 TTGTTTTTGGTTCTCAAGACAGG - Intronic
1148516102 17:48219211-48219233 GGGTTTTAGTTTCTCAACAATGG - Intronic
1149761015 17:59230109-59230131 GTGTTATAGAAACTGAACACTGG + Intronic
1150129439 17:62659237-62659259 GGGGTTTAAGATTTCAACACAGG + Intronic
1150337733 17:64342615-64342637 GTTTTTTAGGATCTCCTCAGGGG + Intronic
1151643582 17:75414327-75414349 GTGTTTTAGGAAGTCCACTCTGG - Intergenic
1155162245 18:23205558-23205580 GGGAGTTAGGACCTCAACACAGG - Intronic
1158322291 18:56276758-56276780 CTATTTTAGGACTTCAACACAGG - Intergenic
1159610046 18:70514626-70514648 GTGTTTTAGGATTTAACAACAGG - Intergenic
1160001505 18:75028501-75028523 GGGTGTTAGGACTTCAACACAGG + Intronic
1162895362 19:13762277-13762299 GTGTTCTTGGCCCTCAACACAGG + Exonic
1162918736 19:13888220-13888242 TTTTTTTAACATCTCAACACAGG + Intronic
1163174185 19:15552652-15552674 GTGTTTGAGGAACTCACCAGGGG + Intergenic
1166633818 19:44431821-44431843 GGGATTTAGGATTTCAACATAGG - Intronic
1166806732 19:45492188-45492210 GTGTTTTAGGGTCTCAGAAAGGG - Intronic
927048101 2:19300302-19300324 GTCTTTCTGGATCTCAACAATGG - Intergenic
927111509 2:19867136-19867158 CTGGGTTAGGATCTCAACTCTGG + Intergenic
931891445 2:66677235-66677257 TTGTTTTGGGATCTCAACTCAGG + Intergenic
932056890 2:68454646-68454668 GTGTTTGTGGCTTTCAACACTGG - Intergenic
935607379 2:104984580-104984602 GGGGGTTAGGATTTCAACACAGG - Intergenic
940952598 2:159693039-159693061 GTGCTTTTGGAGGTCAACACAGG - Intergenic
941597551 2:167496672-167496694 GAGAGTTAGGATTTCAACACAGG - Intergenic
942496196 2:176542153-176542175 GTGTTTTAGGTTCTCTACAAAGG + Intergenic
944309173 2:198214069-198214091 GTCTTTCAGGATTTCAACATTGG - Intronic
945000804 2:205348038-205348060 CTGTTCTAGGAGCTCAACACTGG + Intronic
945092548 2:206189222-206189244 GTGTGTGAGGAACTCTACACAGG - Intronic
947397968 2:229705287-229705309 GTCCTTTAGAATTTCAACACTGG - Intronic
1169851363 20:10055187-10055209 GTTTTTTAGGATGCCAAAACAGG - Intronic
1169855795 20:10101275-10101297 GTGTTGTAAGATGTCACCACTGG + Intergenic
1171167121 20:22981755-22981777 GGGAGTTAGGATTTCAACACAGG + Intergenic
1174399484 20:50268219-50268241 GTTTTTTAGAATCTGAACATGGG + Intergenic
1175116046 20:56683182-56683204 GTGTTTTAAGAACACTACACGGG + Intergenic
1178686478 21:34715236-34715258 GGGGGTTAGGATCTCAACACAGG - Intronic
1178854239 21:36237550-36237572 GTGTTCTAGGATTTCAGTACTGG + Intronic
1179105761 21:38398807-38398829 GTGTTAAAAGATCACAACACTGG - Intronic
1180061822 21:45389221-45389243 GGGTTTGTGGAACTCAACACAGG - Intergenic
1180482749 22:15770112-15770134 CTGTTTAGGCATCTCAACACAGG - Intergenic
1181847926 22:25727866-25727888 GTGGTTTATAAGCTCAACACTGG + Exonic
1184813265 22:46851824-46851846 GGGTTTTAGGCTCTTAACAGGGG + Intronic
952057102 3:29460977-29460999 TTGTTTTATGATCTCACCATTGG + Intronic
956645691 3:71453503-71453525 CTGTAATAGGATTTCAACACAGG + Intronic
958915067 3:100040657-100040679 GTGTTTCATGATAACAACACTGG - Intronic
959654784 3:108790644-108790666 TTATTTTAGTATCTCTACACAGG + Intergenic
961429751 3:126872926-126872948 AAGTTTCAGCATCTCAACACAGG + Intronic
965307753 3:167088312-167088334 TTGTTTTAGCATCTAAACATGGG + Intergenic
968290462 3:197535148-197535170 GGGGGTTAGGATTTCAACACAGG + Intronic
970258946 4:14203209-14203231 TTGGTTTAGGATTTGAACACAGG + Intergenic
972266839 4:37468462-37468484 CTGTGTTAGGATCTCACCTCTGG + Intronic
972588582 4:40462008-40462030 CTGTATTAGGCTCTCAACATTGG - Intronic
973344167 4:49036497-49036519 TTGAGTTAGGATCTCAAGACAGG - Intronic
977799328 4:101207191-101207213 GTGTTTTAGGATGTTAGCAGTGG - Intronic
980967749 4:139539698-139539720 GGGTGTTAGGAGTTCAACACAGG - Intronic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
982203721 4:152981661-152981683 GGGGGTTAGGATTTCAACACAGG - Intergenic
984525033 4:180848573-180848595 GTGTTTTAGCAGCTGAGCACAGG + Intergenic
985293782 4:188412905-188412927 GTGGTTTAGGAACTGAAAACAGG - Intergenic
986329026 5:6703850-6703872 GTATTTGAGGACCTCAACCCTGG - Intergenic
987092574 5:14521415-14521437 GTGTGTAAGGATCTCGAGACAGG - Intronic
987503011 5:18737270-18737292 TTGTTTTAGGATGCCAGCACTGG - Intergenic
988883860 5:35533833-35533855 TTAGTTAAGGATCTCAACACGGG + Intergenic
992388246 5:76306377-76306399 GGGTTTTAGGAGCTCAATGCCGG + Intronic
994378680 5:99044089-99044111 GGGGGTTAGGATTTCAACACAGG - Intergenic
999711158 5:154319790-154319812 GTGTTTTAGGATCTCAACACTGG - Intronic
1002718879 5:181246219-181246241 GCGTTTTAGGTCCTCAACCCGGG - Intronic
1005319284 6:24636275-24636297 GGATTTTAGGATCTGAACATAGG + Intronic
1013822210 6:114168188-114168210 GTGTTTTAGAAGCTCAAGAGAGG + Intronic
1018275207 6:162123041-162123063 GTGTTTAAGGAACTCAAAATGGG - Intronic
1020895049 7:13929500-13929522 GTGTGTCAGGATCTGAAGACTGG - Intronic
1023576913 7:41637688-41637710 GTGTTTTAGGTTCTGGGCACTGG - Intergenic
1023813978 7:43934942-43934964 GTATTTTAGGTACTCAACTCAGG + Intronic
1025090923 7:56063927-56063949 GTGTTTTGGGATGTCAGCAGTGG + Exonic
1025785338 7:64638776-64638798 GAGTTTCAGAATCTCAACAGTGG - Intergenic
1025786568 7:64649437-64649459 GAGATTTAGGACCTCAACAGTGG - Intergenic
1028351122 7:89850231-89850253 GTGTTTGAGGTTCTGACCACTGG + Intergenic
1030105125 7:105980959-105980981 TTGTTTTAGGTTGTCACCACTGG + Exonic
1031894783 7:127336563-127336585 GTGATTAAGGATCTTAAAACAGG - Intergenic
1033485908 7:141789084-141789106 GTAGTTTAGCCTCTCAACACCGG + Intergenic
1037819315 8:22128139-22128161 GTGTTTTAACATCTCATCCCTGG + Intronic
1041040942 8:53845158-53845180 GGGAGTTAGGATTTCAACACAGG + Intergenic
1041101634 8:54401521-54401543 GTGCTTTAGAATCTCATCAGTGG + Intergenic
1041264244 8:56048091-56048113 GGGGGTTAGGATCTCAACATAGG + Intergenic
1042211419 8:66384761-66384783 GTAATTTAGGATCTCAATTCTGG - Intergenic
1045030132 8:98127224-98127246 GGGGGTTAGGATTTCAACACTGG + Intronic
1045832073 8:106474361-106474383 GTGTTTTGGGATACAAACACTGG + Intronic
1047148873 8:122238097-122238119 GGGATTTAGGATTTCAACATAGG + Intergenic
1047851276 8:128860119-128860141 GGGTATTAGGATTTCAACACAGG + Intergenic
1053433529 9:38059648-38059670 GTGTTTCAGAATCAAAACACGGG + Intronic
1055726679 9:79237591-79237613 GGGGGTTAGGATTTCAACACAGG + Intergenic
1057037984 9:91825415-91825437 CTGTTTTATGTTCTCACCACAGG - Intronic
1061470713 9:130823220-130823242 GTTTTTTAGGAGCTGGACACTGG + Intronic
1185671012 X:1810267-1810289 GGGGTTGAGGATTTCAACACAGG - Intergenic
1186468821 X:9805410-9805432 GTGGGTTAGGATTTCAACACCGG - Intronic
1187280640 X:17856286-17856308 GGGGATTAGGATTTCAACACAGG - Intronic
1188558857 X:31444773-31444795 ATTTTTTAGGATTTCAACATAGG - Intronic
1190958373 X:55220237-55220259 GTGGTTTAGGTTCTCCACAGAGG + Intronic
1194514379 X:94832950-94832972 GAATTTTGGGATCTCAACATTGG - Intergenic
1194552828 X:95321838-95321860 GTGCTCCAGGATCTCTACACAGG - Intergenic
1200374109 X:155761050-155761072 GAGTTATAAGATTTCAACACAGG - Intergenic