ID: 999712353

View in Genome Browser
Species Human (GRCh38)
Location 5:154329759-154329781
Sequence GATGAAGCACAGAGGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 1, 1: 0, 2: 5, 3: 57, 4: 470}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999712353_999712361 -1 Left 999712353 5:154329759-154329781 CCTCCCACCCTCTGTGCTTCATC 0: 1
1: 0
2: 5
3: 57
4: 470
Right 999712361 5:154329781-154329803 CTGGCGACTCACCAAAGGGATGG 0: 1
1: 0
2: 2
3: 8
4: 87
999712353_999712362 3 Left 999712353 5:154329759-154329781 CCTCCCACCCTCTGTGCTTCATC 0: 1
1: 0
2: 5
3: 57
4: 470
Right 999712362 5:154329785-154329807 CGACTCACCAAAGGGATGGCAGG 0: 1
1: 0
2: 0
3: 3
4: 67
999712353_999712360 -5 Left 999712353 5:154329759-154329781 CCTCCCACCCTCTGTGCTTCATC 0: 1
1: 0
2: 5
3: 57
4: 470
Right 999712360 5:154329777-154329799 TCATCTGGCGACTCACCAAAGGG 0: 1
1: 0
2: 0
3: 2
4: 46
999712353_999712359 -6 Left 999712353 5:154329759-154329781 CCTCCCACCCTCTGTGCTTCATC 0: 1
1: 0
2: 5
3: 57
4: 470
Right 999712359 5:154329776-154329798 TTCATCTGGCGACTCACCAAAGG 0: 1
1: 0
2: 0
3: 6
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999712353 Original CRISPR GATGAAGCACAGAGGGTGGG AGG (reversed) Intronic
900183127 1:1321128-1321150 GAGGCAGCACAGGGGGCGGGGGG - Intronic
900238488 1:1603717-1603739 GGAGAAGCAGTGAGGGTGGGGGG - Intergenic
900240981 1:1617093-1617115 GATGAAGCCCTGAGGCGGGGAGG - Intronic
900523153 1:3115911-3115933 GATGCTGGACACAGGGTGGGAGG - Intronic
900628845 1:3623297-3623319 GAGGAAGAACAGAGGCCGGGAGG - Intergenic
900996057 1:6124284-6124306 GAGGACACACAGAGGGTGGGAGG - Intronic
901003617 1:6161109-6161131 GATGAAGGAAAGAGGGAGGGAGG + Intronic
901006644 1:6174926-6174948 GATGAAGGATGGATGGTGGGTGG + Intronic
902373969 1:16021626-16021648 GAAAAAGCACAGAGGGAGAGGGG - Intronic
902841162 1:19074767-19074789 GAGGGAGAACAGAGGGTGGAAGG + Exonic
903292919 1:22326074-22326096 GAAGATTCACAGAGGGAGGGAGG - Intergenic
903676006 1:25065104-25065126 GATGAGGCACAGAGAGGGGAAGG - Intergenic
903951581 1:26998809-26998831 GAAGAAACAGAGAGGGAGGGCGG + Intronic
903972737 1:27129640-27129662 GATGAAGCCCAGAGAGGGGACGG + Intronic
904924125 1:34032640-34032662 GATGAGGCGCAGAGAGAGGGTGG + Exonic
906058555 1:42933957-42933979 TCTGAACCACAGAGGGTTGGGGG - Intronic
906288971 1:44607397-44607419 GCTGGAGCACAGAGAGTGAGGGG - Intronic
906713972 1:47953215-47953237 GATGATGCACAGAGGGGTGTGGG + Intronic
907241092 1:53081496-53081518 GCTGAAGCACAGAGAGTGAGGGG + Intronic
907420298 1:54342546-54342568 GGTGAAGGACAGGGTGTGGGAGG - Intronic
907437537 1:54459108-54459130 AAGGAAGGACAGAGGGAGGGAGG + Intergenic
907777432 1:57531658-57531680 AATAAAGCAGAGAGGGAGGGAGG + Intronic
907979713 1:59469737-59469759 GGTGGAGGACAAAGGGTGGGAGG - Intronic
908230537 1:62100416-62100438 CATGAGGCAGAGAGGGAGGGGGG + Intronic
908981328 1:69962819-69962841 ACTGGAGGACAGAGGGTGGGAGG + Intronic
909156335 1:72082199-72082221 GATTAAGCATGGAGGGTGGCAGG + Intronic
909928992 1:81473131-81473153 GATGATGGAGAGTGGGTGGGAGG + Intronic
910542635 1:88378413-88378435 GATGCATCAAAGAGGGTGGGTGG - Intergenic
911448151 1:98026474-98026496 TATGAAACACAGAGGCTGGAAGG - Intergenic
912209300 1:107541109-107541131 GATGGAACACAAAGGGTGGGTGG - Intergenic
914976882 1:152374025-152374047 GCTGAAGCACAGTGAGTGAGAGG + Intergenic
915314998 1:155023499-155023521 CAGGAAGCACAGAGGGTGGGTGG - Intronic
917111799 1:171556358-171556380 CAGGAAGCACAAGGGGTGGGGGG - Intronic
917651288 1:177080179-177080201 GAGGAAGGACAGTAGGTGGGTGG - Intronic
918289310 1:183091477-183091499 GAGGAAGGGCAGAGGGAGGGAGG - Intronic
918425505 1:184405600-184405622 GATGAAGGGGACAGGGTGGGAGG + Intronic
918809769 1:189100985-189101007 GATTAGGCAGAGAGGGAGGGAGG + Intergenic
919727848 1:200895410-200895432 GAAGGGGCACAGAGGGAGGGAGG - Intronic
920413199 1:205778679-205778701 TATGAAGCAGAGAGGATGAGTGG - Intergenic
920631256 1:207654925-207654947 GAGGCAGCAAAGAGGCTGGGTGG + Intronic
920641785 1:207759375-207759397 GAGGCAGCAAAGAGGCTGGGTGG + Intronic
920999049 1:211024441-211024463 GCTGAAGCACAGTGAGTGGGAGG + Intronic
922228170 1:223663736-223663758 GATGAACCACGGTGGGCGGGAGG + Intronic
922248531 1:223824804-223824826 GATAGAGCACAGAGTGAGGGGGG - Intronic
922588514 1:226754093-226754115 GGTGGAGAACAGAGGGTGGAGGG + Intergenic
922625703 1:227039563-227039585 GATGAAGGAGAGAGGGTCAGGGG - Intronic
922776380 1:228215957-228215979 GATGAAGCAGGCAGGGTGGTGGG + Intronic
923478138 1:234356716-234356738 GATGAAGCAGAAGGAGTGGGTGG + Intergenic
924581619 1:245328914-245328936 AATGAATCACAGAATGTGGGTGG - Intronic
924851712 1:247837730-247837752 GAAGAGGCACAGAGGTTGGGGGG - Intergenic
1063371639 10:5526121-5526143 GATGAATCACGGTGGGTTGGCGG - Exonic
1063525252 10:6778851-6778873 GAAGAAAGAAAGAGGGTGGGAGG + Intergenic
1063948847 10:11203964-11203986 GATGAAGCTCAGAGGCTGAGTGG + Intronic
1065070239 10:22015670-22015692 GATGAGAGACAGAAGGTGGGGGG + Intergenic
1065182683 10:23142746-23142768 GAGGAAGGAGAGAGGGAGGGAGG + Intergenic
1065492382 10:26294729-26294751 AATCAAGCCCACAGGGTGGGAGG + Intronic
1066261407 10:33733039-33733061 AATGAAGCAGGGAGGGAGGGAGG + Intergenic
1066528844 10:36313859-36313881 GAAGAAGCAAACAGAGTGGGTGG - Intergenic
1067104947 10:43360404-43360426 GATGGAGCACAGAGAGTAGGCGG + Intergenic
1067930659 10:50558175-50558197 GAAGAAGCACAGAGGCAGGAGGG - Intronic
1069557087 10:69405621-69405643 GAGGAAGCACACACGGTGAGTGG + Intronic
1069616134 10:69807302-69807324 AATGAATCACAGATAGTGGGAGG - Intronic
1070358211 10:75661161-75661183 GAGGAAGCACGGAGGGGCGGTGG - Intronic
1070514314 10:77189522-77189544 GATGAAGTACAGATGGGGAGGGG + Intronic
1070731125 10:78828975-78828997 GATGGAGACCACAGGGTGGGCGG + Intergenic
1070933904 10:80278992-80279014 GATTAAGCAAAGATGGTGTGGGG + Intronic
1072705335 10:97676901-97676923 AATCAAGCATATAGGGTGGGTGG + Intergenic
1073149730 10:101303522-101303544 GATGAAGCAGGGAGGGGGAGAGG - Intergenic
1073192327 10:101660506-101660528 GATGAGGCAGAGAGGGAGGCGGG - Intronic
1073313290 10:102559690-102559712 AATGAAACCCAGAGGATGGGGGG - Intronic
1073446273 10:103582383-103582405 GATGGTGCATAGAGGCTGGGGGG - Intronic
1074466128 10:113682477-113682499 GGGGAAGCAGAGAGGGTAGGTGG - Intronic
1074472737 10:113742209-113742231 GGGGAAGGCCAGAGGGTGGGGGG - Intergenic
1075190463 10:120302547-120302569 GATGGAGCCCAGAGGCTGGCAGG + Intergenic
1075232213 10:120690305-120690327 GGTGGGACACAGAGGGTGGGTGG + Intergenic
1075656316 10:124163399-124163421 GAGGAAGCAGGGAGGGAGGGAGG + Intergenic
1076838663 10:133033770-133033792 AATGTAGCAAAGAGGGTGGCGGG + Intergenic
1076843217 10:133056793-133056815 GAAGAAGCACAGAACGTGGCTGG - Intergenic
1077280606 11:1743430-1743452 GATGAAGGACAGATGGAGGATGG + Intronic
1077383455 11:2258104-2258126 GATGAAGGACTGAGGGAGAGTGG + Intergenic
1077402271 11:2365052-2365074 GAGGAAGCCCAGAGGGAGAGAGG + Intergenic
1078512095 11:11992480-11992502 GCTGAGTCACAGAGGGTGGGTGG - Intronic
1079518580 11:21297881-21297903 GATGAGGGACAGAAGGAGGGAGG + Intronic
1079595614 11:22242178-22242200 GTTGAAGACCAGATGGTGGGAGG + Intronic
1081415909 11:42815820-42815842 GACAAAGCACATAGGGTTGGGGG - Intergenic
1081549863 11:44101090-44101112 GAGGAAACACAGTGGGTTGGGGG + Intronic
1081633172 11:44703004-44703026 GATGACTCACAGTGTGTGGGGGG + Intergenic
1081651867 11:44829310-44829332 GATGGAGCACAGAGGATTTGGGG - Intronic
1081695672 11:45107520-45107542 GAAGCAGAACAGAGGGTGGATGG + Intronic
1081909010 11:46688276-46688298 GATGGAGCACAGTGGGTTGAAGG + Intronic
1082079131 11:47998470-47998492 GATGAGGCACAGAGAGGTGGAGG + Intronic
1082656634 11:55865951-55865973 GAGGGAGGAGAGAGGGTGGGGGG - Intergenic
1083840411 11:65301321-65301343 GGTGAGGCACAGGGGGTGGGAGG - Intronic
1084020447 11:66414121-66414143 GAGGAAGCACAGGGGCTGGGGGG + Intergenic
1084296609 11:68216332-68216354 GCTGAGCCACAGAGGCTGGGGGG + Intergenic
1084452558 11:69248517-69248539 GGGGAAACAGAGAGGGTGGGAGG - Intergenic
1084499368 11:69525702-69525724 GATGCCGCACAGAGGCTGAGGGG - Intergenic
1085402941 11:76245455-76245477 GCTGAAGCCCAGAGGGTAGGAGG + Intergenic
1085773149 11:79342438-79342460 GAGGAGGCGAAGAGGGTGGGAGG + Intronic
1086844334 11:91730180-91730202 GAGGAAGCACAGTGGGAGTGAGG + Intergenic
1087235060 11:95708871-95708893 GATAAAGCCCAGAAAGTGGGAGG - Intergenic
1087445912 11:98253268-98253290 GTTGAAGGGCAGGGGGTGGGTGG - Intergenic
1087517538 11:99182605-99182627 GATGATGCCCAGAGGATGGAGGG - Intronic
1088993047 11:114971162-114971184 TATCAAGCACCGAGGGTGGTAGG + Intergenic
1089325531 11:117654209-117654231 GATGTTGGCCAGAGGGTGGGAGG + Intronic
1089425923 11:118374766-118374788 GATGAGGCACAGAGAGTGAGGGG + Intronic
1089651967 11:119920426-119920448 GCTGAAGCACAAAGGGAGGCAGG - Intergenic
1089989687 11:122847622-122847644 AAGGAAGTCCAGAGGGTGGGTGG + Intronic
1089990676 11:122856897-122856919 GATGACTCACAGAGGGGTGGGGG - Intronic
1090082408 11:123622859-123622881 GGTGGGGAACAGAGGGTGGGAGG - Intronic
1090229722 11:125092815-125092837 GATGAATCACAGAGGGAGGCAGG + Intergenic
1090964301 11:131584868-131584890 GATGCAGCACTGAGAGGGGGAGG - Intronic
1091401339 12:182430-182452 GCTGGAGCTCAGCGGGTGGGCGG + Intergenic
1091565572 12:1645728-1645750 GAAGAGGCCCAGAGGGTGGCTGG - Intronic
1091985695 12:4909141-4909163 GAGGAGGGACATAGGGTGGGAGG + Intergenic
1091986070 12:4910910-4910932 GGAGAAGCAGAGAGGGTGGCAGG + Exonic
1092458754 12:8668439-8668461 GATGAAGAACGGGAGGTGGGAGG - Intergenic
1093235920 12:16608209-16608231 GAAGAAGAAAAGAGGGAGGGAGG + Intronic
1094270742 12:28611601-28611623 TAAGAAGTACTGAGGGTGGGTGG + Intergenic
1095102025 12:38195131-38195153 GATGAAGGACAGAGAGTGTAAGG - Intergenic
1095190756 12:39255627-39255649 GATGAAGCACAGAGAGTGTTTGG + Intergenic
1095956866 12:47811993-47812015 TATGAAGAACAGAGGAGGGGTGG - Intronic
1096311391 12:50524444-50524466 GCTGAAGCACAATGGGTGAGGGG - Intronic
1097045782 12:56187155-56187177 GAAGTAGCAGGGAGGGTGGGGGG - Intronic
1097248873 12:57621494-57621516 GAGGAAGGACGGAGGGTGGAGGG + Intronic
1097301400 12:58023086-58023108 CATGAAGCACAAGGGGTTGGGGG - Intergenic
1100287165 12:93177925-93177947 GCTCAGGCACAGAAGGTGGGGGG + Intergenic
1100868603 12:98886020-98886042 GAGGAAGGAAAGAGGGAGGGAGG + Intronic
1102425068 12:112837823-112837845 GATGAAGGACAGAGGGGAAGAGG - Intronic
1102524968 12:113505986-113506008 GCTGCAGCAGAGAGAGTGGGAGG - Intergenic
1103728399 12:123010494-123010516 CATGAAGAATACAGGGTGGGAGG + Intronic
1104633593 12:130424594-130424616 GGTGAAGCACAGGGGCTCGGGGG - Intronic
1105606131 13:21927810-21927832 GATCAAGCACATGGGGTGAGAGG + Intergenic
1109302075 13:60600005-60600027 GAAAAGGCACAGAGGGTGGGTGG + Intergenic
1111924789 13:94451114-94451136 GAGGAATCAGAGAGGGTGGCTGG - Intronic
1112341117 13:98553600-98553622 GATGCTGCACAGAGACTGGGAGG + Intronic
1112809718 13:103203696-103203718 GACAAAGGAGAGAGGGTGGGAGG - Intergenic
1112948770 13:104963341-104963363 ACTGAAGCATAGAGAGTGGGAGG - Intergenic
1113333031 13:109349834-109349856 GATGGAGCACAGAGTCTGGAAGG + Intergenic
1113653646 13:112055476-112055498 GAGGAGGCAGAGAGGGAGGGTGG + Intergenic
1117372442 14:55090874-55090896 GAGGAGACACAGAGGGTAGGTGG + Intergenic
1118005553 14:61561852-61561874 GAGGAAGCACAGGGGCTGTGGGG + Intronic
1118105406 14:62653504-62653526 AATGAAGCTCAGAGGGTAAGTGG + Intergenic
1118675480 14:68180227-68180249 GATGGAGCACAGATGGTTTGGGG + Intronic
1118780802 14:69006372-69006394 AATGAGACACAGAGGATGGGTGG - Intergenic
1118865983 14:69703979-69704001 GAGGAAGCAGTAAGGGTGGGAGG - Intronic
1119177889 14:72582788-72582810 GATGAACCAGACAGGGTGGAGGG - Intergenic
1119421236 14:74509158-74509180 GGTGAAGCCCAGCAGGTGGGGGG - Intronic
1119681221 14:76593575-76593597 GGTGAAGCTCAGAGTGAGGGTGG + Intergenic
1119716400 14:76862702-76862724 GGTGAGCCACAGAGAGTGGGAGG + Intronic
1119732945 14:76962635-76962657 GCTGGAGCTCACAGGGTGGGAGG + Intergenic
1120312266 14:82844401-82844423 GATGAAGCACAGGGTCTTGGTGG + Intergenic
1120853611 14:89193533-89193555 GATGAATAACAGAAGGTGGGGGG - Intronic
1121233838 14:92377953-92377975 GATGAAGGTCTGGGGGTGGGAGG + Intronic
1121764912 14:96478167-96478189 AAGGAAGGACAGAGGGAGGGCGG + Intronic
1122147419 14:99699973-99699995 GATGCGGGAAAGAGGGTGGGGGG - Intronic
1122322229 14:100862004-100862026 GAGGAAGAAGAGAAGGTGGGAGG - Intergenic
1122650051 14:103221177-103221199 GATGGAGCACACAGGGTGGAGGG + Intergenic
1122926411 14:104905062-104905084 GATTAAGCAGTGAGGGTGAGGGG - Intergenic
1123989887 15:25675565-25675587 GATGAACCCCAGGGGCTGGGAGG + Intergenic
1123996061 15:25718750-25718772 GAGGCAGGACAGAGGGTGGCAGG + Intronic
1124199244 15:27663072-27663094 GCTGGAGCACAGAGGGAGAGGGG - Intergenic
1124845396 15:33284846-33284868 GAAAAAGCAAAGAGGGTGGAAGG + Intergenic
1125093490 15:35824083-35824105 GAAGAAGAACTAAGGGTGGGAGG - Intergenic
1125501959 15:40245491-40245513 AAGAAAGCACAGAGGGTGGAGGG + Intronic
1125530070 15:40407272-40407294 GCTGGAGCACAGAGGGTGGGAGG + Intronic
1126350777 15:47742825-47742847 CAGGAAACACAGAGGGTGTGGGG - Intronic
1126927392 15:53605335-53605357 ACTGAAGAACAGAAGGTGGGAGG + Intronic
1127977044 15:64005503-64005525 GAAGCAACTCAGAGGGTGGGAGG + Intronic
1128055979 15:64700519-64700541 GATGAAGCACAGGGGTGGAGGGG - Intronic
1128596063 15:68950791-68950813 GATGAAACACAGAGGGTTTTAGG - Intronic
1128636758 15:69307541-69307563 GATGAGGCCCTGAGGGTAGGAGG + Intronic
1129002816 15:72348023-72348045 GAGGAAGGAAGGAGGGTGGGTGG - Intronic
1129240490 15:74249064-74249086 GACTAAGCAGGGAGGGTGGGGGG - Intronic
1129367642 15:75066319-75066341 GCTCAAGCACAGAAGGAGGGGGG - Intronic
1129525727 15:76212847-76212869 TATGCAGGACAGAGGGAGGGAGG - Intronic
1129880522 15:79003635-79003657 GAGGCAGCACAGAGTCTGGGCGG - Intronic
1131828551 15:96339810-96339832 GATGAAGTACTGGCGGTGGGGGG - Exonic
1131879202 15:96844594-96844616 GATGAAGCACAGAAAGAGAGAGG - Intergenic
1132047305 15:98575194-98575216 GATGAAGAAGAGAGGGAGGAGGG - Intergenic
1132194562 15:99902841-99902863 GATGAAGCAGAGAGAGAGAGAGG + Intergenic
1132299606 15:100767827-100767849 GCTGAAGCTCAGAGAGTGGCAGG + Intergenic
1132558728 16:583980-584002 GATGACGCGCTGTGGGTGGGAGG + Exonic
1132693011 16:1190028-1190050 GATGAAGGAGGGAGGGTGAGTGG + Intronic
1133260051 16:4543275-4543297 AATGAAACACAGAGTGTGTGGGG + Intergenic
1133417023 16:5614890-5614912 GAGGAAGAACACAGGGAGGGTGG + Intergenic
1133575171 16:7082033-7082055 TATGAACCAGAGAGGATGGGAGG - Intronic
1133596077 16:7294123-7294145 GTCGAAACACAGAGAGTGGGTGG + Intronic
1133712040 16:8410788-8410810 TCAGAAGCAGAGAGGGTGGGAGG + Intergenic
1134183041 16:12062820-12062842 GCTGAAGCACAGAGGCAGGGCGG + Intronic
1134225331 16:12385616-12385638 GCTGATGCACACAGGGTGGGAGG - Intronic
1134675144 16:16085182-16085204 GATGGAGCACAGCAGGAGGGAGG - Intronic
1134691142 16:16191722-16191744 GAGGAAGGACAGAGGGAAGGAGG - Intronic
1135223982 16:20639506-20639528 GAGGATCCCCAGAGGGTGGGTGG - Intronic
1135609898 16:23857348-23857370 GAATCAGCACAGAGGGAGGGAGG + Intronic
1135625180 16:23988832-23988854 GCTGGAGCACGGAGGGTGAGAGG + Intronic
1136083412 16:27867764-27867786 GAGGAAGCCGAGTGGGTGGGTGG - Intronic
1136092061 16:27927662-27927684 GGTGGAGCACTGAGGATGGGTGG - Intronic
1137736235 16:50725940-50725962 TAGGAAGGACAGAGGGTTGGTGG - Intronic
1137798679 16:51242869-51242891 GATGAAGCACAAGGGTTGGCTGG + Intergenic
1138619715 16:58201319-58201341 GAAGGTGCACGGAGGGTGGGTGG - Intergenic
1140288654 16:73629135-73629157 GATGACACACGGAAGGTGGGAGG - Intergenic
1140704562 16:77614597-77614619 GGTGAAGCTCAGAGGGTTGAAGG - Intergenic
1140746307 16:77983319-77983341 CAAGAAGCACAGAGGGCAGGAGG + Intergenic
1141062170 16:80883614-80883636 GATGAAGTTCAGAGACTGGGTGG + Intergenic
1141359510 16:83382508-83382530 GATGGAGCACTGAGGGTTGAAGG - Intronic
1141526093 16:84612898-84612920 ACTGAGGCACAGAGGGAGGGAGG + Intronic
1141693523 16:85609513-85609535 CTTGAACCACAGAGGGTGGGCGG - Intergenic
1143768267 17:9151546-9151568 GATAAAGCACAGGTGGTGGTGGG + Intronic
1144131296 17:12250135-12250157 GATGATGGACAGGGGGTGGGAGG - Intergenic
1145031411 17:19507646-19507668 GAGGAAGCCCAGAGGGCAGGGGG - Intronic
1145994311 17:29096753-29096775 GAAGAAGCAGAGGAGGTGGGTGG - Exonic
1147191284 17:38739506-38739528 AAGGAAGCACGGAGCGTGGGAGG + Intronic
1147325625 17:39668149-39668171 GGTGAGGAACTGAGGGTGGGGGG + Exonic
1147575116 17:41594545-41594567 AAGGAAGCACAGAGGGAGGGAGG + Intergenic
1147575128 17:41594593-41594615 GAAGGAGGACAGAGGGAGGGAGG + Intergenic
1147945559 17:44078345-44078367 GGTGAAGCCCAGAGGGATGGGGG + Exonic
1148618252 17:49015635-49015657 GTGGAAGCACAGAGAATGGGGGG - Intronic
1149283718 17:55137288-55137310 GCAGAAGGACAGAGGGAGGGAGG - Intronic
1149633682 17:58148719-58148741 AATTTAGAACAGAGGGTGGGAGG + Intergenic
1151145795 17:72039745-72039767 AATAAAGAACAGAGGGTGTGGGG + Intergenic
1151146493 17:72046456-72046478 GCTGAAGCACAGAAGGTGGCTGG + Intergenic
1151316155 17:73323983-73324005 GCAGAGGGACAGAGGGTGGGGGG - Intergenic
1151409499 17:73912460-73912482 GAAGAAGGAAAGAGGGAGGGAGG - Intergenic
1151834396 17:76573479-76573501 CAAGAAGCACAGAGGGTGGGAGG + Intronic
1152380046 17:79937593-79937615 GATCAAGTACAGAGGGAGGGAGG - Exonic
1152525242 17:80884671-80884693 GATGGGCCACAGAGCGTGGGAGG - Intronic
1152784987 17:82243061-82243083 GTTGAAGTACAGAGGGAGGTTGG - Exonic
1153193196 18:2565347-2565369 GATGGAGGTCAGAGGATGGGAGG + Intronic
1153383022 18:4459088-4459110 AATGAAGCGTAGAGGGTGGTGGG + Intergenic
1153750974 18:8230256-8230278 AATGAAGAACAGAGAGTGGCTGG + Intronic
1153845185 18:9043114-9043136 AAGGAAGAAGAGAGGGTGGGAGG - Intergenic
1155581634 18:27314757-27314779 GATGAAGCACAGTGGATGGATGG + Intergenic
1155778623 18:29801216-29801238 AAAGAAGTACAAAGGGTGGGGGG + Intergenic
1155925252 18:31649086-31649108 GAGGCAGCACAGAGTGTGGGAGG - Intronic
1156677267 18:39543005-39543027 GAGGAAGCACAGATGTTAGGAGG + Intergenic
1157471964 18:47996177-47996199 ATTGAAGCAGAGAGGGTGGGAGG + Intergenic
1157558680 18:48631083-48631105 CAAGAAGCTCAGAGTGTGGGAGG - Intronic
1158221909 18:55159290-55159312 GGTGACGCCAAGAGGGTGGGAGG + Intergenic
1158515166 18:58124545-58124567 GATGGAGCACAGAGGTGAGGAGG - Intronic
1158544823 18:58387040-58387062 GAAGAAACACAGAGGGAGGCAGG - Intronic
1160211261 18:76882060-76882082 CTAGAAGCACAGAGGGAGGGCGG - Intronic
1160273570 18:77409659-77409681 GGTGAAGCACTGAGGGAGGTGGG + Intergenic
1160872146 19:1282410-1282432 GAGGAAGGAGAGAGGGAGGGAGG + Intergenic
1160899089 19:1418069-1418091 GATGCTGCACTGGGGGTGGGGGG - Intronic
1161026193 19:2038464-2038486 GTTGGAGCATGGAGGGTGGGGGG + Exonic
1161195093 19:2982239-2982261 GAGAAAGCACAGAGGGGGGCCGG + Intronic
1161287677 19:3477303-3477325 GATGATAGACAGATGGTGGGTGG + Intronic
1162063290 19:8109799-8109821 GATGAAGCTAGGAGGGAGGGGGG - Intronic
1162292799 19:9792200-9792222 GATGAAGGAGAGACGGTGGCGGG - Intronic
1162932453 19:13963746-13963768 CCTGGGGCACAGAGGGTGGGCGG + Exonic
1163183358 19:15619333-15619355 GAAGAAGAAAGGAGGGTGGGGGG - Intronic
1164739828 19:30567621-30567643 GAGGGAGCATAGAGAGTGGGTGG + Intronic
1165746251 19:38231449-38231471 CATGAAGTGCAGAGAGTGGGTGG - Intergenic
1166035542 19:40165571-40165593 GAAGAAGCACAGAGAGTCCGAGG - Intergenic
1166499655 19:43331289-43331311 GAGGAAGCACAGAGACTGGCTGG - Intergenic
1166945259 19:46392232-46392254 GTTGAAGCTGAGGGGGTGGGGGG - Intronic
1167108621 19:47446126-47446148 GCGGAAGCGCAGAGGCTGGGAGG + Intronic
1168385128 19:55956743-55956765 CATGCAGCACAGAGGGAGGGAGG - Intronic
1168677161 19:58286887-58286909 GATGAAGCAGAGAGGGAGGAAGG - Intronic
925606163 2:5662508-5662530 GATGGAGCACAGAAGGTTTGTGG - Intergenic
926244664 2:11113795-11113817 GAGAAAGGACAGAGGGAGGGAGG - Intergenic
926615809 2:14995593-14995615 AACAAAGCACAGAGTGTGGGTGG - Intergenic
927135951 2:20096682-20096704 AATGGAGGGCAGAGGGTGGGTGG - Intergenic
927591802 2:24363085-24363107 CCTGAATCACACAGGGTGGGAGG - Intergenic
927964586 2:27261448-27261470 TCTGAAGCGCAGAGGCTGGGTGG + Intronic
929324948 2:40598510-40598532 GATGAATCTCAGAGAGTGGCTGG + Intronic
930241340 2:48938510-48938532 GAGGAAGGAGAGAGGGAGGGAGG - Intergenic
931873270 2:66484273-66484295 GATGAGGCAGAGAGGGTGAGCGG - Intronic
932878143 2:75474474-75474496 GAGGAAGCACAGAAGTTGTGTGG + Intronic
933176438 2:79179069-79179091 GATGAAGCAGAAAGGGAGGACGG + Intergenic
933596693 2:84289921-84289943 GCTGCAGAACAGAAGGTGGGAGG + Intergenic
934650700 2:96089779-96089801 GAGGAAGCAAAGACGGAGGGTGG + Intergenic
934756699 2:96829217-96829239 GAAAAAAGACAGAGGGTGGGGGG - Intronic
935153498 2:100461332-100461354 ACTCAGGCACAGAGGGTGGGAGG + Intergenic
935307901 2:101755655-101755677 GATGAGGAACAGAGGGAGAGCGG - Intronic
937367198 2:121271993-121272015 GATGCAGCTCTGAGGGAGGGTGG - Intronic
937421541 2:121760391-121760413 GCTGAAGCACAGAGAGAGGTAGG + Intronic
937851399 2:126639446-126639468 GCAGAAGCACAGAGGGAGGTTGG - Intergenic
938762532 2:134438800-134438822 AATGATGCACAGTGGGTGAGTGG - Intronic
940692551 2:156937429-156937451 GAGGAAGGAAAGAGGGAGGGAGG + Intergenic
943785645 2:191875578-191875600 GTTGAAGCAGAGAGGCAGGGTGG + Intergenic
944661764 2:201927267-201927289 GATGAGGAACAGAGGCTCGGAGG - Intergenic
944934290 2:204551584-204551606 GATTATACACAGAGGGTGTGTGG - Intronic
945113636 2:206389415-206389437 GAGAAAGCACAGAGGGTGACTGG + Intergenic
945483059 2:210364715-210364737 GGTGAATCACAGAGGGAGGCTGG + Intergenic
946624409 2:221595197-221595219 GGTGAAGAAGAGAGGGTGGCTGG + Intergenic
947483548 2:230525620-230525642 CAGGAAGCACAAGGGGTGGGGGG + Intronic
947816882 2:233043353-233043375 GATGGAGCAGAGAGGATGAGCGG + Intergenic
948456681 2:238107728-238107750 GAGGAGGCACACAGAGTGGGAGG - Intronic
948669964 2:239561895-239561917 GAGGAAGCACACAGGCTGGGCGG + Intergenic
948855261 2:240727356-240727378 GAGGAAGGACAGAGGCAGGGAGG + Intronic
1168787090 20:549094-549116 GATGAACTACAGAGGGAGAGAGG - Intergenic
1168794911 20:604959-604981 GATGATGGAGAGAGGATGGGAGG + Intronic
1169002401 20:2177491-2177513 GTTGGAGCACAGAGGGTATGGGG - Intergenic
1169010585 20:2246913-2246935 GAGGAAGCAGATGGGGTGGGAGG - Intergenic
1169292010 20:4360836-4360858 GATGTAGCAAAAAGGGTGGAAGG + Intergenic
1169318743 20:4613698-4613720 GATAAAGGAGAGAGGTTGGGAGG + Intergenic
1169648582 20:7842045-7842067 GCTGAAGCAAAAAGGGAGGGAGG - Intergenic
1170160886 20:13309227-13309249 GATGAATGACAGTGAGTGGGTGG + Intergenic
1170171320 20:13416368-13416390 GGTGAAGCAAAGGGGGAGGGTGG + Intronic
1171253475 20:23668300-23668322 GATTTCGCAGAGAGGGTGGGTGG + Intergenic
1171369812 20:24654627-24654649 GAGGAAGGAGAGAGGGAGGGAGG + Intronic
1172949465 20:38713454-38713476 GGCAAAGCACAGAGGGTGGCAGG + Intergenic
1173218957 20:41115640-41115662 GCTAAAGCACTCAGGGTGGGGGG + Intronic
1173225070 20:41157781-41157803 GATGGAGCAGAGAGGGTGAGAGG + Intronic
1174114248 20:48215888-48215910 AATGAACCCCAGTGGGTGGGCGG - Intergenic
1174132302 20:48354364-48354386 CCTGGAGCTCAGAGGGTGGGAGG + Intergenic
1174167551 20:48595981-48596003 CATGAACCCCAGTGGGTGGGCGG + Intergenic
1174708028 20:52676842-52676864 AAAGAAGGTCAGAGGGTGGGAGG + Intergenic
1174872844 20:54199556-54199578 GGTGAAGCACAGTGAGTGAGGGG + Intergenic
1175157492 20:56981405-56981427 AAGGAGGCAGAGAGGGTGGGAGG - Intergenic
1175185180 20:57175105-57175127 AATGAAGCACAGACGGCTGGGGG + Intronic
1175392497 20:58636073-58636095 GAGGGAGCACAGAGAGAGGGAGG + Intergenic
1175392534 20:58636193-58636215 GAGGGAGCACAGAGAGAGGGAGG + Intergenic
1175749071 20:61482703-61482725 GATGAAGCACAGTGATTGGCTGG - Intronic
1175790318 20:61736588-61736610 GATGAAGGGGAGAGGGAGGGAGG + Intronic
1175938460 20:62526052-62526074 GATGAAGGACATGGGATGGGAGG - Intergenic
1176186838 20:63784868-63784890 GATGATGCACAGAGGGGTTGGGG + Intronic
1176229262 20:64023451-64023473 GAGGACGGACAGAGGGTGCGTGG - Intronic
1176659856 21:9624082-9624104 GATGAAGGAAAGAACGTGGGAGG + Intergenic
1179010198 21:37550786-37550808 GAAAAAGCAGAGAAGGTGGGAGG + Intergenic
1179096699 21:38322540-38322562 AATGCACCACAGAGGGTGGGTGG + Intergenic
1179464605 21:41563238-41563260 GATGAAGAACAGGAGGTGGGAGG - Intergenic
1179789568 21:43748695-43748717 GGTGAAGGAGAGAGGGAGGGAGG - Intronic
1179801372 21:43812966-43812988 GAAGAAGCAAAGTGTGTGGGGGG - Intergenic
1180579755 22:16822197-16822219 CATGTAGCACAGAGGCTGAGAGG + Intergenic
1181133028 22:20745256-20745278 GCTGAAGCAGAGAGAGTGGCTGG - Intronic
1181161868 22:20964424-20964446 GCTGGAGCACAGAGGCTGTGTGG - Intergenic
1181811783 22:25407622-25407644 GTTGAAGCAGAAAAGGTGGGAGG - Intergenic
1181884649 22:26010659-26010681 GATGAAGGACAGAGGATGGAAGG - Intronic
1182034169 22:27184491-27184513 GATGAATAACAAACGGTGGGAGG + Intergenic
1183673131 22:39284514-39284536 GGTGTAGCACAGAGGGCTGGAGG + Intergenic
1183731541 22:39621401-39621423 GATGGACCACAGAGGTTGGCTGG - Intronic
1183903165 22:41021531-41021553 GAGGTCGCACAGATGGTGGGTGG + Intergenic
1184173635 22:42773464-42773486 CAGGAAGCACGGAGGTTGGGGGG + Intergenic
1184293244 22:43509158-43509180 GATGATGGACGGAGGGAGGGAGG - Intergenic
1184871298 22:47240108-47240130 TTTGCAGAACAGAGGGTGGGAGG + Intergenic
1185104349 22:48858873-48858895 GATGAATGATGGAGGGTGGGAGG - Intergenic
1185109893 22:48895024-48895046 GGTGCAGCTCACAGGGTGGGTGG - Intergenic
1185275965 22:49950353-49950375 GGGGAAGCACAGAGGGGTGGGGG + Intergenic
950217236 3:11168381-11168403 GATGACGCACAGAGGAAGCGGGG + Intronic
950423908 3:12914501-12914523 TATGAAGGAGAGAGGATGGGAGG + Intronic
950434047 3:12967876-12967898 GAAGAAGCACAGGGGGCGGGGGG + Intronic
950905197 3:16531282-16531304 GATGAAACAAATGGGGTGGGAGG + Intergenic
951160916 3:19420440-19420462 TGTGACGCACAGAGGGAGGGCGG + Intronic
951439544 3:22707314-22707336 GGGGAAGCACAAGGGGTGGGGGG - Intergenic
952975085 3:38687056-38687078 GCTGAAGCACAGGGAGTGAGTGG + Intergenic
953530417 3:43735522-43735544 GATGAAGCAGTGTGGGTGAGGGG - Intergenic
953717066 3:45324646-45324668 CATGAGGCACAGAGGGTGGGTGG - Intergenic
954422084 3:50424147-50424169 GATGCAGCACAGGGTGTGTGAGG + Intronic
955034132 3:55249842-55249864 GTTGGAGAGCAGAGGGTGGGAGG - Intergenic
955044218 3:55344594-55344616 GATGAAGCACTGACTCTGGGGGG - Intergenic
955341662 3:58129948-58129970 GATGAAGCACAGAGGAGTCGAGG - Intronic
955470172 3:59278545-59278567 GCTGAAGCATAGAAGATGGGAGG - Intergenic
956227116 3:66972789-66972811 GAGGAAGCATAGAGGGTGCGAGG - Intergenic
957006677 3:74956642-74956664 GAAGAAGCACTGAGGTTAGGGGG - Intergenic
957387670 3:79518407-79518429 AAAGAAGCACGGAGGGAGGGAGG - Intronic
957895637 3:86418319-86418341 GATGTAGCAAAGGAGGTGGGGGG - Intergenic
958059968 3:88467070-88467092 TATGAAGCAAATATGGTGGGCGG + Intergenic
958727910 3:97928400-97928422 GCTTGAGCAGAGAGGGTGGGAGG + Intronic
960739514 3:120817492-120817514 AATGGAGCACAGAGGAAGGGAGG + Intergenic
961169151 3:124783979-124784001 GATGAAGGACAAAGGGTGAGGGG - Intronic
961482951 3:127195780-127195802 GATGAGGCACAGAGAGACGGTGG - Intronic
962158238 3:132971928-132971950 GTTGAACCACTGAGGTTGGGGGG - Intergenic
962283957 3:134071484-134071506 GAGGAGGCAAAGAGGGTGTGTGG - Intronic
963952130 3:151214488-151214510 AAGGAAGAACAGAGGGAGGGAGG - Intronic
964682138 3:159353161-159353183 GATCAAGCACAAAGGAGGGGAGG + Intronic
966239852 3:177744166-177744188 GAGGAAGCACAGAGCGTTTGGGG + Intergenic
966331818 3:178823211-178823233 GAAGAAACACAGAGGGTGGGTGG + Intronic
968592181 4:1464783-1464805 GGTGAGTCCCAGAGGGTGGGGGG - Intergenic
968684930 4:1951657-1951679 ACTGAAGCACAGAGTGTAGGTGG - Intronic
968762978 4:2451845-2451867 GATGATGGACACAGGGTTGGTGG + Intronic
969182212 4:5450957-5450979 CAAGAAGCACAGAGTGTGGATGG - Intronic
969437236 4:7195051-7195073 GATGGGGCACTGGGGGTGGGGGG + Intronic
970684952 4:18556502-18556524 GATGAAGAAATGGGGGTGGGTGG - Intergenic
971042119 4:22765264-22765286 TTAGATGCACAGAGGGTGGGAGG + Intergenic
972601984 4:40581042-40581064 GTGGGAGCACAGAGGTTGGGAGG + Intronic
972606516 4:40618977-40618999 GAGGAAGGACTGAGGATGGGGGG - Intronic
973041559 4:45475783-45475805 GCTCAGGCACAGAGGGAGGGGGG + Intergenic
973187611 4:47349132-47349154 TCTGGAGCACAGAGGGAGGGAGG + Intronic
973550096 4:52025509-52025531 GAAGAAGCACGGAGGGTGAAGGG + Intronic
975078792 4:70249216-70249238 GACGTACCACAGTGGGTGGGTGG - Exonic
975700145 4:77057161-77057183 GATGTAGTAGAGAGGGAGGGAGG - Intronic
976092591 4:81473202-81473224 AGTGAAACACAGAGGCTGGGTGG + Intronic
979314862 4:119250094-119250116 GATGAAGCACTGAGGGAAGGTGG - Intronic
980706324 4:136500501-136500523 GATAAAAAACAAAGGGTGGGGGG + Intergenic
982205567 4:152995166-152995188 GCTGAGGCCCAGAGGCTGGGTGG + Intergenic
982769564 4:159383886-159383908 GATGAAGGAATGAGGGTGAGGGG + Intergenic
983691045 4:170469582-170469604 GAGGAAGGAGAGAGGGAGGGAGG - Intergenic
983691053 4:170469605-170469627 GAGGAAGGAAAGAGGGAGGGAGG - Intergenic
985293721 4:188412356-188412378 GAGGAAGCACAGGGAGTGGAAGG + Intergenic
985415519 4:189732325-189732347 GATGAAGGAAAGAACGTGGGGGG - Intergenic
985641647 5:1066110-1066132 CCTGAAGGTCAGAGGGTGGGAGG - Intronic
986185077 5:5428098-5428120 GATGAAGCACAGAGTAAAGGTGG + Intronic
988441946 5:31243389-31243411 AAGGAAGCACAGGGGGTGGTTGG + Intronic
989205708 5:38807177-38807199 GATGATGACCAGAGGGTTGGGGG - Intergenic
989305140 5:39946556-39946578 CAAGAGGCACGGAGGGTGGGGGG - Intergenic
990194876 5:53303332-53303354 GATGAAGCAGAAAAGGTGTGAGG + Intergenic
991429590 5:66530424-66530446 GATGAGGGAGAGAGGGAGGGAGG - Intergenic
991608211 5:68424245-68424267 CATGAACCAAAGAGTGTGGGTGG - Intergenic
991952686 5:71962083-71962105 GATGAGGCAAAGAGGATGGGAGG + Intergenic
992183989 5:74225897-74225919 GAGGAAGGAAAGAGGGAGGGAGG - Intergenic
992185008 5:74235465-74235487 GAGAAAGCACAGAGAGTTGGGGG - Intergenic
992664601 5:78994872-78994894 CATGAAGCACAGAGGTGGTGGGG - Intergenic
993799241 5:92310695-92310717 TAAGAACCACAGGGGGTGGGAGG - Intergenic
994650713 5:102523500-102523522 GAAGAAACACAGGGGGTTGGGGG + Intergenic
994687182 5:102969961-102969983 GAGGAAGCACAGATGATAGGTGG + Intronic
995414709 5:111896144-111896166 GAGGAAGCACAGAGATTGGTAGG + Intronic
997135314 5:131319220-131319242 AGTGAGGCACTGAGGGTGGGGGG - Intronic
997651372 5:135523860-135523882 GAGGCTGCACAGAGCGTGGGGGG + Intergenic
998068548 5:139178487-139178509 GTTGGAGCACAGAGAGTGAGAGG - Intronic
999208346 5:149866502-149866524 GAAAAAGGCCAGAGGGTGGGAGG + Intronic
999227919 5:150042586-150042608 GGTGCAGCTCAGAGTGTGGGAGG + Intronic
999477774 5:151916943-151916965 GAGAAAGGACAGAGTGTGGGAGG + Intronic
999712353 5:154329759-154329781 GATGAAGCACAGAGGGTGGGAGG - Intronic
1000210011 5:159100141-159100163 GATACACCAGAGAGGGTGGGGGG + Intergenic
1001445535 5:171779820-171779842 GAGGAAGGAGAGAGGGAGGGAGG + Intergenic
1001540227 5:172532660-172532682 GAGGAGGCACCCAGGGTGGGTGG + Intergenic
1001967046 5:175917663-175917685 GCAGAACCACAGATGGTGGGAGG - Intergenic
1002194441 5:177494604-177494626 CAGGAAGCACAGAGGATGAGGGG + Intronic
1002249889 5:177921549-177921571 GCAGAACCACAGATGGTGGGAGG + Intergenic
1002516047 5:179759799-179759821 GATGAGGAACACAGGTTGGGAGG + Intronic
1003078975 6:3005836-3005858 GTTGAGGCACAGAGGGGTGGAGG + Intronic
1004413250 6:15400894-15400916 GAAGAAGGACAGAGGGAGGGAGG - Intronic
1005004914 6:21278320-21278342 GAGGCAGGAGAGAGGGTGGGAGG + Intergenic
1005397723 6:25400532-25400554 CATGAAGCACAGCTGGTGGGGGG - Intronic
1006262475 6:32886768-32886790 AATAAAGCACAGCTGGTGGGAGG - Intergenic
1006750393 6:36373275-36373297 GGTGCAGCACAGAGGAAGGGCGG + Intronic
1008370464 6:50724741-50724763 GTTGCAGCACAGACGGTGGCGGG + Intronic
1008671005 6:53768736-53768758 CACAAAGCACAAAGGGTGGGTGG + Intergenic
1009167946 6:60363371-60363393 GAAGAAGGAGAGAGGGTGAGAGG - Intergenic
1010171848 6:72984646-72984668 CAGGAAGCACAAGGGGTGGGGGG - Intronic
1010273738 6:73945179-73945201 CATGGAGGACAGAGGGTGGGAGG - Intergenic
1011146204 6:84220022-84220044 GATAATGCACAGAGGCAGGGAGG + Intronic
1012733106 6:102906648-102906670 GAGGAAGCAGATAAGGTGGGAGG - Intergenic
1013195299 6:107839409-107839431 GAGGAAGAAGAGAGGGAGGGAGG + Intergenic
1013198794 6:107870530-107870552 GATGAATCATTGAGGGAGGGTGG - Exonic
1015178951 6:130341128-130341150 AAAGAAACACAGAGGGAGGGAGG + Intronic
1015633293 6:135252376-135252398 GATGAGGCACAGAGGGAGGCCGG - Intergenic
1016369655 6:143359632-143359654 TATAAAGCACAAAGGATGGGAGG + Intergenic
1017523168 6:155219979-155220001 GATGAACAACAGAGCGTGGCAGG + Intronic
1017621644 6:156305304-156305326 GATGTAACACAGAGGGTAGTTGG - Intergenic
1018368322 6:163144948-163144970 GATGGGGAAAAGAGGGTGGGAGG - Intronic
1018746537 6:166766805-166766827 GCAGAAGCACAGAGGTTGCGAGG + Intronic
1019138799 6:169929945-169929967 GATGAAGCCCACAGGGAGGGTGG + Intergenic
1019326854 7:442728-442750 GATGAAGGATAGATGGTGGAAGG + Intergenic
1019436868 7:1026849-1026871 GATGAAGCCCAGAGGCTGCCTGG - Intronic
1019664792 7:2246434-2246456 GCAGAAGCACAGAGGGCTGGAGG + Intronic
1019743480 7:2687426-2687448 GGTGAAGCAGAGCTGGTGGGAGG + Intronic
1020281720 7:6653371-6653393 GTGGAAGCCCAGCGGGTGGGAGG - Exonic
1020586957 7:10080409-10080431 GTTCCAGCACAGAGGGAGGGGGG + Intergenic
1023229645 7:38013198-38013220 GATGAAGCACAGATGATTTGGGG - Intronic
1023940754 7:44767207-44767229 GCTGATGCACAGAGGGAGTGTGG + Intronic
1024243583 7:47453463-47453485 GAGGAAGGAAAGAGGGAGGGAGG - Intronic
1024262013 7:47580508-47580530 GTGGTAGCACAGGGGGTGGGGGG - Intronic
1024295641 7:47839752-47839774 GATGGCCCACAGAGGGTGGATGG + Intronic
1024755564 7:52526077-52526099 GATGAAGCCCAGAGGGCTGCTGG + Intergenic
1024977329 7:55125956-55125978 GATGAAGCTGAGAGTGTGAGGGG - Intronic
1026432657 7:70362619-70362641 GAGGAAGGAGAGAGGGAGGGAGG - Intronic
1027126388 7:75559639-75559661 GATGCGGCACAGAGGCTGGGTGG - Intronic
1027716529 7:81678326-81678348 GATGAAGCACAAAGTGTGCTGGG + Intergenic
1028066183 7:86387861-86387883 TATGAAGCACTGAGGATGAGAGG - Intergenic
1029348624 7:99997206-99997228 GAGGAAGGACAGAGGGAGGGAGG - Intergenic
1030177704 7:106671940-106671962 CGGGAAGCACAGAGGGTCGGGGG + Intergenic
1030593447 7:111508544-111508566 GAGAGGGCACAGAGGGTGGGAGG + Intronic
1030680735 7:112431012-112431034 CATGAAGAAAAGAAGGTGGGAGG - Intronic
1030684410 7:112469836-112469858 GATGAAGAAAAGAAGGTGGGCGG - Intronic
1031086730 7:117309429-117309451 GGAGAAGCTCAGAGGGTGAGGGG - Intronic
1031866990 7:127048325-127048347 GATGAAGCAGAGAGAATAGGAGG + Intronic
1033785602 7:144726709-144726731 GTTGAAGCATAAAGTGTGGGTGG + Intronic
1034587420 7:152107372-152107394 ACTGAAGCTAAGAGGGTGGGGGG + Intronic
1034605308 7:152307323-152307345 GAGGAAGGAAAGAGGGAGGGAGG + Intronic
1035348246 7:158222568-158222590 TATGAAAGGCAGAGGGTGGGAGG + Intronic
1035395773 7:158534004-158534026 GATGGAGCCCGGGGGGTGGGTGG - Intronic
1035395835 7:158534204-158534226 GATGGAGCCCGGGGGGTGGGTGG - Intronic
1035971980 8:4258638-4258660 GATGAAGTTCTGAGGGTAGGTGG - Intronic
1036184158 8:6609845-6609867 GGTAAACCACAGAGGGTGAGGGG + Intronic
1037742731 8:21620421-21620443 AATGGAGATCAGAGGGTGGGAGG - Intergenic
1039225247 8:35381010-35381032 AATGAAGCAGGGAGGGAGGGAGG + Intronic
1040678526 8:49781432-49781454 CAAGAAGCAAAGAGGGTGGTTGG - Intergenic
1041764579 8:61404915-61404937 GATCTAGCAAAGAGGATGGGAGG + Intronic
1043372888 8:79613161-79613183 CATAGAGAACAGAGGGTGGGCGG - Intronic
1043560527 8:81488350-81488372 TATGAAGCACTGAGGGTCTGGGG - Intergenic
1044122115 8:88410841-88410863 GAGGAAACACAGAAGGTGGATGG + Intergenic
1044653253 8:94521197-94521219 GAAGGAGAACAGAGGGTTGGGGG - Intronic
1045839062 8:106558757-106558779 GATGAATCACATAGGATGTGAGG + Intronic
1047470994 8:125172190-125172212 GGTGCAGCACAGAGGGTGGCTGG - Intronic
1047852317 8:128870403-128870425 TGGGAAGAACAGAGGGTGGGAGG - Intergenic
1048578747 8:135713507-135713529 GGTAAAGCACAGAGGGAAGGAGG + Intergenic
1048607316 8:135982899-135982921 GATAAACAGCAGAGGGTGGGAGG + Intergenic
1048690294 8:136955669-136955691 GAGGAAGAAGGGAGGGTGGGAGG - Intergenic
1049062420 8:140286549-140286571 CAGGAAGCACTGAGGGAGGGAGG + Intronic
1049356785 8:142193013-142193035 GATGAAGGAGAGTGGGAGGGAGG + Intergenic
1050019706 9:1270101-1270123 GATGAAGCAGAGAGGGAGAGAGG - Intergenic
1052750706 9:32486748-32486770 GATGAAGCTCAGAGGGCAGGAGG + Intronic
1053402644 9:37839772-37839794 GAATAAGCAAAGAGGGTGGCTGG - Intronic
1054813065 9:69450114-69450136 GATGAGGCTCTGTGGGTGGGTGG + Intronic
1055364505 9:75528150-75528172 GAAGGAGCAGAGAGGGTGGTAGG + Intergenic
1056406007 9:86275788-86275810 GAAGTAGCACACAGGGTGGAAGG + Intronic
1056541284 9:87573464-87573486 GAAGGAGCAGAGAGGGAGGGAGG + Intronic
1056547795 9:87627477-87627499 GAGCAAGCAAAGGGGGTGGGTGG - Intronic
1057695202 9:97318271-97318293 AAGGAGGGACAGAGGGTGGGTGG - Intronic
1058050108 9:100397107-100397129 GATGTGGCACAGAAGGTGAGAGG - Intergenic
1058705747 9:107636948-107636970 GAGGAAGAAGAGAGGGTAGGGGG + Intergenic
1058857096 9:109073179-109073201 CATGTAATACAGAGGGTGGGAGG - Intronic
1059503669 9:114778576-114778598 AATGAAGCAGAGAGGTTGGTAGG + Intergenic
1059933258 9:119282496-119282518 GAAGAAGGACAGAGGGAGGAGGG + Intronic
1061929512 9:133825182-133825204 GATGAAGGACCTGGGGTGGGGGG + Intronic
1062054149 9:134462302-134462324 GTTGAAGCACAGCAGCTGGGCGG + Intergenic
1062144058 9:134979101-134979123 GAGGAAGGAGAGAGGGAGGGAGG + Intergenic
1062201336 9:135304397-135304419 GATGAATGATGGAGGGTGGGTGG + Intergenic
1062385691 9:136310678-136310700 GCTGGGGCCCAGAGGGTGGGGGG - Intergenic
1062457255 9:136645633-136645655 GCAGAAGCACGGGGGGTGGGGGG - Intergenic
1062527374 9:136983421-136983443 GATGCAGAACTGAGGGAGGGGGG - Exonic
1203637419 Un_KI270750v1:125926-125948 GATGAAGGAAAGAACGTGGGGGG + Intergenic
1186223924 X:7377070-7377092 GAAGACGGACACAGGGTGGGAGG - Intergenic
1186486237 X:9936527-9936549 CTTGAAGCACAGCGGGCGGGGGG + Intronic
1188137309 X:26505223-26505245 GAAGAAGCAGAGTGGGTGGGGGG - Intergenic
1189233575 X:39470932-39470954 GATCAAGCTCAGAGGGTTGGAGG - Intergenic
1189281552 X:39822617-39822639 GATGAAGGAAGGAGGGTAGGTGG - Intergenic
1190732299 X:53234140-53234162 GAGGAAGCAAAGAGGGTGCAAGG + Exonic
1193912975 X:87328005-87328027 GCTGAAGAACAGGGGGTTGGTGG - Intergenic
1194614891 X:96088020-96088042 GATGTATCATGGAGGGTGGGTGG - Intergenic
1194622947 X:96196095-96196117 GAAAAAACACAGGGGGTGGGGGG + Intergenic
1195905437 X:109840067-109840089 TATGAAGAACAGCGGGTGGGAGG + Intergenic
1196209573 X:112980916-112980938 GTTGAAGCAGAGATGGTGAGAGG - Intergenic
1197186252 X:123590485-123590507 AAGGAAGCACAGAGGATGGGTGG - Intergenic
1198575301 X:138004182-138004204 GCTGGAGCATAGAGGGTGAGGGG + Intergenic
1199604163 X:149563406-149563428 TATGAAGCACAGAGGTTTGTAGG - Intergenic
1200567614 Y:4786430-4786452 GATGGAGGATGGAGGGTGGGAGG + Intergenic
1201741217 Y:17326092-17326114 GAAGAAGGAGAGAGGGAGGGAGG + Intergenic
1201938673 Y:19435090-19435112 CAGGAAGCACAAAGGGTTGGGGG + Intergenic