ID: 999712864

View in Genome Browser
Species Human (GRCh38)
Location 5:154333754-154333776
Sequence GAGAAAAGGGGGCAGTGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 313}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999712864_999712872 6 Left 999712864 5:154333754-154333776 CCTGATCACTGCCCCCTTTTCTC 0: 1
1: 0
2: 2
3: 28
4: 313
Right 999712872 5:154333783-154333805 TTAGGCACCCAGCCCAGAGGAGG 0: 1
1: 0
2: 1
3: 11
4: 194
999712864_999712871 3 Left 999712864 5:154333754-154333776 CCTGATCACTGCCCCCTTTTCTC 0: 1
1: 0
2: 2
3: 28
4: 313
Right 999712871 5:154333780-154333802 CAATTAGGCACCCAGCCCAGAGG 0: 1
1: 0
2: 0
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999712864 Original CRISPR GAGAAAAGGGGGCAGTGATC AGG (reversed) Intronic
900900525 1:5512916-5512938 GGAGAAAGGGGGCTGTGATCTGG + Intergenic
901926211 1:12567775-12567797 GAGAGAAGGGGGCCGAAATCAGG - Intergenic
902464597 1:16608183-16608205 GAGAAATGGGGGCAGAGAATGGG + Intronic
903156211 1:21445522-21445544 GAGAAATGGGGGCAGAGAATGGG - Intronic
903860771 1:26363220-26363242 GAGAGAAGTGGGCAGAGATTTGG - Intronic
903884474 1:26532807-26532829 CAGAACTGGGGGCAGTGGTCTGG + Intronic
905695099 1:39968104-39968126 GAAAAATGGGGGCTGTAATCTGG + Intronic
905973863 1:42161759-42161781 GAGAAAAGGGGACCAGGATCAGG - Intergenic
906207022 1:43992271-43992293 GAGAAGAGGGGTCAGAGATGGGG - Exonic
906288327 1:44602941-44602963 GAGAGAAGGAGGCAGGGAGCAGG - Intronic
906376332 1:45299641-45299663 GAGGAAGGGGGCCTGTGATCAGG - Intronic
906715064 1:47962512-47962534 GGGCAAAGGGGGCAGGTATCAGG - Intronic
908404642 1:63802602-63802624 GAGAAGAGAGGGTAGAGATCTGG - Intronic
908903573 1:68983174-68983196 GAGAAAAGGGGGCAGGAGACAGG + Intergenic
912641804 1:111353430-111353452 TAGAGAAGGTGGCAGTGATGGGG - Intergenic
913369796 1:118085443-118085465 GATAAAAGAGTGCAGTGGTCAGG + Intronic
914489629 1:148143091-148143113 GAGAAATGGGGGCAGAGAATGGG + Intronic
915138346 1:153749909-153749931 TAGAAAACAGGGCAGTTATCTGG - Intronic
915460900 1:156070133-156070155 GAGGGCAGAGGGCAGTGATCAGG - Intronic
916075819 1:161199502-161199524 GAGAAAAGAGGGTAGGGAACAGG + Exonic
916075836 1:161199627-161199649 GAGGCAAGGAGACAGTGATCAGG + Intronic
916396246 1:164390884-164390906 GAGAAAAGTGGGCAGATTTCGGG - Intergenic
916419010 1:164619038-164619060 GAGAAAAGGGTAAAATGATCAGG + Intronic
918434373 1:184496104-184496126 TAGAAAAGGGGGCAGGTAACAGG + Intronic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
920106301 1:203555912-203555934 GAGAGGAGGGGGCAGTGGGCTGG + Intergenic
920178856 1:204120307-204120329 GAGGCAAGGGGACAGTGATCTGG + Intronic
920303025 1:205001134-205001156 TAGAAAAGGGGTTAGTGATGAGG - Intronic
921774247 1:219078825-219078847 TAGAAAATGGGGCAGGGATAGGG - Intergenic
921774333 1:219079629-219079651 TAGAAAATGGGGCAGGGATCAGG - Intergenic
922321807 1:224495233-224495255 GAGAGAAGGGGGCTGGGATCAGG - Intronic
922343149 1:224673579-224673601 GAGTAGAGAGGGAAGTGATCAGG - Intronic
922636050 1:227172569-227172591 GAGAAAAGCGGGGAGTAATGGGG + Intronic
1063079189 10:2749194-2749216 GTGAAAAGTGGTCTGTGATCAGG - Intergenic
1063126025 10:3137375-3137397 CAGAAATGGGGGCAGAGAGCTGG + Intronic
1064134353 10:12737480-12737502 GAGGAAAGAGGGCAGGGGTCTGG - Intronic
1064186959 10:13170205-13170227 GGGAAGTGGGGGCAGTGGTCAGG + Intronic
1064507018 10:16043019-16043041 AAGAAAAGTGGGCTGTGATATGG - Intergenic
1064568462 10:16668263-16668285 GAGATGTGGGGGCAGTGATCAGG + Intronic
1065916627 10:30358650-30358672 GAGAAAAGTGGGCAGAGAGCTGG - Intronic
1067211509 10:44263433-44263455 GAGAAAAGGCAGAAGTGATGGGG - Intergenic
1069913881 10:71775432-71775454 GTGAAAAGGGGGGAGGGAACTGG - Intronic
1071822587 10:89293386-89293408 GAGAAAAGGGGGCCGGGATCTGG - Intronic
1073037497 10:100574598-100574620 GAGAGAAGGGGGCAGAGAGAGGG - Intergenic
1073562107 10:104505822-104505844 GAGAAGAGGAGGGAGAGATCAGG - Intergenic
1074591711 10:114820323-114820345 GAGAAAAGGTGGCTGTCATATGG - Intergenic
1075725101 10:124606945-124606967 GAGAAAAGAGGGCAGAGAGAGGG - Intronic
1075736791 10:124669270-124669292 GGGAGAAGGGCCCAGTGATCTGG - Intronic
1076735835 10:132458579-132458601 GAGCATGGGGGGCAGTGTTCTGG - Intergenic
1078040349 11:7855819-7855841 GAGAAAAGGGGGCAGGGAAGAGG + Intergenic
1078217152 11:9321091-9321113 GAGAAAAGGTGGCAGGAGTCAGG - Intergenic
1078716970 11:13849475-13849497 GAGGAAAGGGGGCAGGGACGTGG - Intergenic
1078917867 11:15796972-15796994 GAGAGAAGGAGGCAGTGGTTAGG - Intergenic
1080299869 11:30772058-30772080 CAAAAAAGGGGGCAGAGGTCGGG - Intergenic
1083319591 11:61837752-61837774 GAGAGCAGAGGGCAGTGATGAGG - Intronic
1083433313 11:62626251-62626273 GAGAAAAGAGCACAGTGAACTGG + Intronic
1083977689 11:66136919-66136941 GAGAAAAGTGGGCAATGCTGAGG - Intronic
1084114069 11:67031718-67031740 CAGAAAAGGGGGCAGGGCTGGGG - Intronic
1084763794 11:71294387-71294409 GAGAAGAGCGGGCAGTGAGAAGG - Intergenic
1085200540 11:74699221-74699243 GAGAGAAGGTGGCAGGGATGAGG + Intronic
1086156700 11:83674661-83674683 CAGAGAAGGGTGCAGTGACCAGG - Intronic
1087265667 11:96058252-96058274 CAGAAAAGGAGGCAATGATGAGG + Intronic
1088320106 11:108546420-108546442 GAGAAAAGTGGAAAGTGTTCAGG + Intronic
1088723966 11:112618359-112618381 GAGAAAATGGGGCAGTGGCCAGG - Intergenic
1089073003 11:115715905-115715927 GAGAATGGGGAGCAGTGAGCAGG + Intergenic
1089279997 11:117367164-117367186 GAGACAAGGGGGCAGGGGCCAGG + Intronic
1090228124 11:125083705-125083727 CGGAAAAGGGGGCAGTGGTCTGG + Intronic
1091602575 12:1926859-1926881 TACAAAAAGGGGCAGAGATCGGG + Intergenic
1091764514 12:3110057-3110079 GGGAAGCGGGGGCAGAGATCTGG - Intronic
1092168618 12:6359294-6359316 GGGAAAAGGGTGTAGTTATCGGG + Intronic
1092230392 12:6772782-6772804 AAGGAAAGGGGGCAGTGGTGGGG - Exonic
1093625048 12:21336126-21336148 GAGAAAAGGGGAGAGAGATTGGG - Intronic
1096100738 12:48969375-48969397 CAGAGATGGGGGCAGTGCTCTGG - Intronic
1096761689 12:53846929-53846951 GAGAAAAGGAGGCAGTTGGCAGG - Intergenic
1096771525 12:53938801-53938823 GAGAAAAGAGGGGAGGGATGGGG + Exonic
1096845555 12:54404642-54404664 GAGAGTAGGGGTCAGTGACCAGG + Intronic
1096982877 12:55738401-55738423 GAGAGAAGGAGGCTGTGTTCCGG - Intergenic
1101437427 12:104676409-104676431 AAGAAAAGGAGGCAGTGACTCGG - Intronic
1102205688 12:111089333-111089355 GAGAAATGGGGGGAGTAATGGGG + Intronic
1102435409 12:112918998-112919020 GAGAATAGGGAGAAGTGAACAGG + Intronic
1102809190 12:115809297-115809319 GAGAACAGGAGGCAGAGATGAGG - Intergenic
1104174226 12:126313782-126313804 GACAAAAGGAGGCTGTGATCTGG + Intergenic
1104290018 12:127457927-127457949 GAGAGAAGTTGGAAGTGATCGGG + Intergenic
1105274061 13:18904606-18904628 GAGAAAAAAGGGTGGTGATCAGG - Intergenic
1106109993 13:26768338-26768360 GAGGAGAGGAGCCAGTGATCAGG + Intergenic
1108301677 13:49083616-49083638 TAGAAAAGAGGGCAGTGACTTGG + Intronic
1108954966 13:56141767-56141789 GAGAAAAGGGAGCATGGAACAGG - Intergenic
1109635990 13:65117838-65117860 GAGCAAAGAGGGCAGAGATGAGG - Intergenic
1110324426 13:74197887-74197909 GAACAAAGAGGGCATTGATCAGG + Intergenic
1110570775 13:77000545-77000567 CAGAAAAGGGGGCAGAGACATGG + Exonic
1114658517 14:24330360-24330382 GGGAAAAGTGGGCAGCGAGCGGG + Intronic
1115163766 14:30424859-30424881 GAGAAAAGGGGCCAGGGAGGAGG + Intergenic
1116918037 14:50544286-50544308 GAGAAAAGAGGGTAGTTATTGGG - Intronic
1116992571 14:51291883-51291905 GAGGGAAGGGGGCAGAGATGGGG - Intergenic
1121456703 14:94043109-94043131 GAGGACAGGGGGCAGTGAGGAGG - Intronic
1121571704 14:94951313-94951335 GGGAACAGGGGACAGTGATTTGG - Intergenic
1122424683 14:101599034-101599056 GAGCAAAGAGGGCCGTGTTCTGG - Intergenic
1123082420 14:105701879-105701901 GGGAACAAGGGTCAGTGATCAGG + Intergenic
1124238752 15:28013023-28013045 GAGAAAAAGTGGCAGGGAGCTGG + Intronic
1124490238 15:30150967-30150989 GAGAAAAGGGAGGAGAGAGCTGG + Intergenic
1124753295 15:32387362-32387384 GAGAAAAGGGAGCAGAGAGCTGG - Intergenic
1124975036 15:34523062-34523084 GACAAAAGGGAGCAGAGAGCTGG - Intergenic
1125064714 15:35468738-35468760 GCGAAAAGGGGACAGTTAGCAGG + Intronic
1125815174 15:42577721-42577743 GTGAGAAGAGGGAAGTGATCCGG - Intronic
1125859300 15:42983233-42983255 TAGAAAAGGGAGCAGTGATGTGG - Intronic
1127860806 15:62992863-62992885 GAGCAAAGGGGATAGTGATTTGG - Intergenic
1127904069 15:63363309-63363331 GAGAGAAGGTGACATTGATCTGG - Intronic
1128157663 15:65401997-65402019 GAGAGAAAGGGGCAGGGAGCAGG + Intronic
1129210465 15:74065109-74065131 GAGAAAAGTGAGCAGAGAGCTGG - Intergenic
1129749132 15:78048167-78048189 GAGAAAAGGGACCAGAGACCAGG + Intronic
1131679068 15:94702505-94702527 GAGAAAAGGGGGCAGTGCAAGGG - Intergenic
1131989829 15:98082545-98082567 GAGGCAAGAGAGCAGTGATCAGG - Intergenic
1132837993 16:1964373-1964395 GAGAAAAGGCGCCAGTGACCAGG + Intronic
1133256120 16:4517437-4517459 AAGAAAAGGGAGCAGTGGCCAGG + Intronic
1137777483 16:51068415-51068437 GAGACATGGGGGCAGGGATAGGG - Intergenic
1139480097 16:67226045-67226067 GACAAGAGGAGGCAGTGATGAGG + Intronic
1141275137 16:82580600-82580622 GAGAAAATGGAGCTGTGAACTGG - Intergenic
1141335419 16:83150357-83150379 GAGAAAAGTGGGTAGGGATAGGG - Intronic
1141855030 16:86674861-86674883 GAGAAAGGGGAAAAGTGATCAGG - Intergenic
1142854551 17:2722593-2722615 GAGAGAAAGGGGGTGTGATCTGG + Intergenic
1143521875 17:7448925-7448947 GAGGAAAGGTGGCAGTCAACGGG - Intronic
1143730599 17:8880676-8880698 CAGAGAAGGGAGCAGAGATCAGG + Exonic
1143977076 17:10837793-10837815 GAGAAAAGGGGGCTATGCCCTGG - Intronic
1145784482 17:27585239-27585261 AAGAAAAGGGGTCAGTCAGCTGG - Intronic
1147311356 17:39597824-39597846 GAGGAAGGGGGGCATTCATCGGG - Intergenic
1147603267 17:41758875-41758897 CAAAAAAAGGGGCAGTGATCAGG + Intronic
1149996296 17:61407719-61407741 GAGAAAACGGGGCAGGCATAGGG - Intronic
1150881066 17:69028598-69028620 GACCAAGGAGGGCAGTGATCTGG + Exonic
1151811797 17:76448013-76448035 GAGAAAATGAGGCAGTGACTTGG + Intronic
1152129318 17:78466557-78466579 GAGAAAAGGGCGCTGGGATTAGG - Intronic
1152211882 17:79006838-79006860 GAGAGAAGGTGGCAGTAAGCAGG - Intronic
1152318278 17:79593537-79593559 CAGAGAATGGGGCAGAGATCTGG + Intergenic
1153476867 18:5506529-5506551 GAGAAAAGGGGGCAGGAAACGGG - Intronic
1157368964 18:47092541-47092563 GAGAAAAAGGTGAAGTGATGGGG - Intronic
1158963589 18:62605669-62605691 GAGAAAAGGGGGATGTGGCCGGG - Intergenic
1160348796 18:78156254-78156276 GTGTGAAGAGGGCAGTGATCTGG + Intergenic
1160747212 19:717739-717761 GAGAAGAGGGGGCCGGGATTGGG + Intronic
1160958957 19:1708925-1708947 GAGAAAACGGGGCGGGGAACTGG - Intergenic
1161324551 19:3657164-3657186 GAGAAAAAGGGGCAGAGAAGTGG - Intronic
1161730737 19:5959085-5959107 GAGAAGAGGGGGCTGTGCTGGGG + Intronic
1162531162 19:11237201-11237223 GAGGGCAGGGGACAGTGATCAGG + Intronic
1163280293 19:16312244-16312266 GGGAAAAGTGGGGAGTGCTCAGG - Intergenic
1163440410 19:17319958-17319980 GAGAACTGGGGGCAGGAATCGGG - Exonic
1164575765 19:29404538-29404560 GAGAAAAGGAAGCAGCGATAGGG + Intergenic
1166302744 19:41921648-41921670 GAGAGAAGAGGGCAGAGATGCGG + Intronic
1166366821 19:42282007-42282029 GAGAGGAGGGGGCAGTGGTAGGG + Intronic
1167367384 19:49061893-49061915 CAGAAAAGGGGGCAATGTTGAGG + Exonic
1167409172 19:49334986-49335008 GAGATAAGGGGACAGAGATGGGG + Intergenic
1167424287 19:49422129-49422151 GAGAGAAGGGGACAGAGATGGGG + Intergenic
1167428296 19:49440945-49440967 GAGAGAAGGGAGCCGAGATCTGG + Intronic
1167662727 19:50805219-50805241 GAGAAAAGGGGGTTGGGAGCTGG + Intergenic
1167720030 19:51172925-51172947 GTGAAAAGGGTTCAGTGATCAGG - Intergenic
1167913537 19:52722453-52722475 TAGAAAGTGGGGCAGTGATGTGG - Intronic
1167954980 19:53057360-53057382 GAGAAAAGTGTAAAGTGATCAGG + Intergenic
1168093375 19:54100431-54100453 GGGAAAAGGGGGCTGGGAACAGG - Intronic
1168134829 19:54343295-54343317 AAGAAAAGGGGGCCGGGCTCAGG - Intergenic
1168137301 19:54360197-54360219 GAGAAAACGGGGCAGGGGACAGG + Intronic
1168160776 19:54508888-54508910 GAGAAAACGGGGCAGGGGACAGG - Intronic
1168197912 19:54789198-54789220 GAGAAAAGAGGGCAGAGAAGTGG + Intronic
925394689 2:3524846-3524868 GAGAAAAGGGGGCAGAAAGAGGG - Intergenic
925480117 2:4261286-4261308 GGGAAAATGGGGCAGGGAACAGG + Intergenic
926137065 2:10343834-10343856 GAGAAGAGGGGGCAGGCCTCAGG + Intronic
927304136 2:21550853-21550875 TAGAAACGGAGGCAGTGATTGGG + Intergenic
927708543 2:25311522-25311544 GCCAAAAGATGGCAGTGATCTGG - Intronic
927883369 2:26704340-26704362 GAGAAAAGGGGTCTGAGAGCAGG - Intronic
928030567 2:27774925-27774947 GAGAATAGGTGGTAGTGTTCTGG + Intronic
928373321 2:30756773-30756795 GAGAAACGGGGGCAGGGAGGGGG + Intronic
929035182 2:37683823-37683845 GAGAAGAGAGGGCTGTCATCTGG - Intronic
930127675 2:47815457-47815479 GAGAAAAGGAGGCAGGAACCAGG + Intronic
930649455 2:53950208-53950230 AAGTCAAGGGGGCAGTGAGCTGG + Intronic
932037517 2:68261188-68261210 AAGAAAAGTGGGCACTGAACAGG - Exonic
932221505 2:70003113-70003135 GAGAAAAAGAGGCAGTTGTCTGG - Intergenic
932497358 2:72153008-72153030 GAGACCAGGAGGCAGTGAGCAGG + Intergenic
933575569 2:84063413-84063435 GAGAAGAGGGGGTAGTGGTGAGG - Intergenic
933873390 2:86593053-86593075 CAGAAAAGCGAGCAGTGAGCTGG - Intronic
934639592 2:96019708-96019730 GGTACAAGGGGGCAGGGATCAGG - Intergenic
934859616 2:97753482-97753504 AAGGAAAGGGGTCAGTGTTCCGG - Intergenic
935056448 2:99571717-99571739 GAGAAAATGGGCCAATCATCAGG - Intronic
938468861 2:131542370-131542392 GAGAAAAGAGGGAGGTGAGCAGG - Intergenic
938585501 2:132686409-132686431 GACAACAAGGGGCAGTCATCAGG - Intronic
938986225 2:136579111-136579133 GAGAAGAGAGGGCAGTCATGGGG + Intergenic
939134921 2:138282348-138282370 AAGGAAAGGAGGCAGTCATCAGG - Intergenic
940374214 2:152939213-152939235 GAGAAAAGGGAGCATAGAACAGG - Intergenic
941834785 2:170004556-170004578 GAGTAAAGGGGGCAGGGGTGGGG + Intronic
943082032 2:183267185-183267207 GAGAAAAGGGGGCAGGAACCAGG + Intergenic
944563949 2:200968645-200968667 AAAAAAAGGGGGCAGTCAGCAGG + Intergenic
944595560 2:201257678-201257700 GAAAAAAGGAGGAAGTGTTCTGG - Intronic
945221461 2:207488481-207488503 GTGATAAGTGGGCAGTGATGGGG + Intergenic
947216880 2:227757949-227757971 CAGAAAAAGGAGCAGTGATGAGG - Intergenic
947352882 2:229264635-229264657 GAGACAAGTGGACAGTGAGCAGG + Intronic
947769906 2:232662362-232662384 GAGAACCAGGGGCAGTGACCAGG + Intronic
948428836 2:237905604-237905626 GAGGACAGGGGTCAGTGTTCAGG + Intronic
948502839 2:238407601-238407623 GAGAGAAGGTGGCAGAGATTTGG + Intergenic
1169142587 20:3234624-3234646 GAGAAAAGCGGGGAGGGCTCAGG + Intronic
1169320635 20:4630618-4630640 TGGAAAAGAGGGCAGTGATTAGG - Intergenic
1169436683 20:5599028-5599050 GAGAAAAGGGGGAAGGCATACGG + Intronic
1172037654 20:32021027-32021049 GAGAAAATGGGGCATGGACCTGG - Intronic
1172240642 20:33410390-33410412 GGGCAAAGGGGCCAGTGACCTGG + Intronic
1172291819 20:33782304-33782326 GAAAAAAGGGAGCAGTGGTCAGG - Intronic
1172460916 20:35117995-35118017 GAGAAAAGTGGGAAGAGATAAGG - Intronic
1172894566 20:38291445-38291467 GAGACAAGGGGCCAGTGAGTGGG - Intronic
1174560027 20:51424555-51424577 TACAAAAGAGGGCAGTGATGAGG + Intronic
1175118296 20:56699500-56699522 AAGAAAAGAGGGCAGGGATTGGG - Intergenic
1175522386 20:59610270-59610292 GTGAGAAGGGGGCAGAGAACAGG - Intronic
1176517619 21:7797845-7797867 GAGCAAAGGTGGCAATGATGTGG + Intergenic
1177898754 21:26887337-26887359 GTGAAATGAGGGCAGTGAGCAGG + Intergenic
1178651647 21:34427857-34427879 GAGCAAAGGTGGCAATGATGTGG + Intergenic
1178756744 21:35357292-35357314 GAGCTAAGGGTGCAGTGAACAGG + Intronic
1179980047 21:44891093-44891115 GAGCAAAGGGGGCAGAGTCCTGG + Intronic
1181553172 22:23652581-23652603 GCGAAAAGGAGGTAGTGCTCAGG + Intergenic
1181879476 22:25966554-25966576 GAGATAACGGGGCAGTAATTAGG - Intronic
1182426831 22:30278086-30278108 GTGAGCAGGGGGCTGTGATCAGG + Intergenic
1184049845 22:41996511-41996533 GAGAAAGGGGGGCGGTGATCAGG + Intronic
1184149600 22:42630566-42630588 GAGAACAGGGGCCAGGGTTCAGG - Intronic
1184212475 22:43044034-43044056 GAGGAGAAGGGGCAGTGGTCAGG - Intronic
1184887714 22:47356616-47356638 GAGAAAAGGGGGCTTTGCTGAGG - Intergenic
1184922351 22:47614410-47614432 GGGAGGAGGGGGCAGTCATCTGG + Intergenic
1184959038 22:47915478-47915500 GTGCAAAGGGGGCAGAGTTCAGG - Intergenic
1185321962 22:50205637-50205659 AGAAAAAGGGGGCAGTCATCTGG + Intronic
949785261 3:7733469-7733491 CAGACAAGGGGGCAGTGGACTGG - Intronic
950639821 3:14341541-14341563 GAGGAAAGCGGGCAGGGAGCAGG - Intergenic
950695927 3:14701187-14701209 GAGAAGTGGGGGAAGTGACCAGG + Intronic
953032874 3:39189452-39189474 GAGAAGAAGGGGCAGAGATGAGG + Exonic
953290558 3:41657008-41657030 GAGAGAAAAGGGCAGTGCTCAGG + Intronic
953850485 3:46462792-46462814 CAGAGAAGGGGGCAGGGAGCTGG + Intronic
954413691 3:50382491-50382513 GGGAGCAGGGGGCAGGGATCAGG - Intronic
955320033 3:57967931-57967953 GTGAAAAGGGAGCAGGGAGCGGG - Intergenic
956679280 3:71762736-71762758 GAGAAAAGAGGGCAGGGAAAAGG + Intergenic
956916867 3:73880938-73880960 GGGAAATGGGGGCAGGGATGTGG + Intergenic
959147396 3:102565443-102565465 GAGAGAAGGGAGCAGTGATATGG - Intergenic
959498140 3:107074768-107074790 GAGAGATGGGGAAAGTGATCAGG + Intergenic
959892445 3:111571151-111571173 AAGAAAAGGGGGCAGGGAAAAGG - Intronic
961040386 3:123674169-123674191 GAGAAATGGGGACAGGGAGCAGG - Intronic
961751498 3:129097959-129097981 GAGCTAAGGAGGCAGAGATCAGG + Intronic
962084809 3:132179531-132179553 GGGAGAAGGGGGCGGTTATCTGG + Intronic
965350117 3:167600886-167600908 GAGAAAAGCGGGAAGTGAAGTGG + Intronic
966421976 3:179742874-179742896 GAGAGAAGGAGGCAGAGATGTGG + Intronic
966875004 3:184316441-184316463 GAGAATTGGGGGCAGTGCTTTGG + Intronic
966975915 3:185083059-185083081 GAGAGAAGGGTGCACTCATCCGG + Exonic
967702640 3:192611338-192611360 CAGAAAAGGAGGCTGTTATCAGG + Intronic
968010131 3:195269124-195269146 GGGACAAGGGGACAGAGATCCGG + Intronic
968520621 4:1033237-1033259 GAGAGAGGGGTGCAGGGATCGGG + Intergenic
969594348 4:8140491-8140513 GGGGAAAGGGGGCAGTGACACGG + Intronic
969704389 4:8784062-8784084 TGGAAAAGGGGGCAGGGATCAGG - Intergenic
970208250 4:13678730-13678752 CAGAACAGGGGTCAGTGAACTGG - Intergenic
970228001 4:13879839-13879861 GAGAATAGGTGCCAGTGAGCTGG + Intergenic
970737906 4:19196014-19196036 GAGAAAAAGGGTCAGTGAAGGGG + Intergenic
972447787 4:39162565-39162587 CAGAAAATGAGGCAGTAATCAGG + Intergenic
973822069 4:54670622-54670644 GAGAAAAGGGAGCAGGAACCAGG - Intronic
976250857 4:83050729-83050751 GAGCAAAGGGGCAAGAGATCAGG + Intronic
976872190 4:89808677-89808699 GAGCAGAGGGGGATGTGATCTGG + Intronic
979469843 4:121082465-121082487 GAGAAAAGGAGACAGTGGTTAGG + Intergenic
979506225 4:121500819-121500841 GACAAAAGGGGCCATTGCTCTGG + Intergenic
981858628 4:149326884-149326906 GAGAACAGTGGGCAGTAATGGGG - Intergenic
983229268 4:165112922-165112944 GAGCTAAGGGGGCGGGGATCGGG - Intronic
985434052 4:189911625-189911647 GAGAAAGGGGGGCTGAAATCCGG + Intergenic
986482494 5:8203023-8203045 CAGGAAAGGGGCCAGTGAACTGG - Intergenic
988901001 5:35732247-35732269 GAGAAATGAGGGCTGTGAGCAGG + Intronic
989153567 5:38322814-38322836 GAGAAAAGCCAGCAGGGATCTGG + Intronic
992285954 5:75236032-75236054 GGGAAAAGAGGGCAGGGATGAGG - Intronic
995116231 5:108482608-108482630 TGGGAGAGGGGGCAGTGATCAGG - Intergenic
996082218 5:119268753-119268775 GAGAAAAGGAGGCAGAGGCCAGG - Intronic
997953956 5:138264068-138264090 GAGAAGAGAGGGCAGTGTTATGG + Intronic
998164745 5:139836630-139836652 GAGAGGAGGGGTCAGAGATCTGG + Intronic
999712864 5:154333754-154333776 GAGAAAAGGGGGCAGTGATCAGG - Intronic
1000070791 5:157739370-157739392 GAAAAAAGATGGCAGTGACCCGG + Exonic
1000151240 5:158503236-158503258 GAGAAATGAGGACATTGATCTGG + Intergenic
1000830794 5:166098757-166098779 GGGAAAAGGAGGCAGGGATAAGG - Intergenic
1001743491 5:174072190-174072212 GAGGAAAGGGGCCAGGGATCAGG - Intronic
1002549024 5:179973314-179973336 GAGAAAAAGGTGCCGTGTTCAGG - Intronic
1002571117 5:180139925-180139947 AAGAAAATGGGGCTGGGATCTGG - Intronic
1002789167 6:425032-425054 GAGAAACTGGAGCAGGGATCTGG + Intergenic
1003501080 6:6703353-6703375 AAGAAAAGGGGCCAGTGCTTAGG + Intergenic
1003533770 6:6958509-6958531 GAAAATAGGGAGCAGTGATGTGG - Intergenic
1004252596 6:14034410-14034432 GAGACAAGTGGGAAGTCATCTGG + Intergenic
1005708402 6:28480164-28480186 GAGACAAGGGGGAAGAGATGAGG - Intergenic
1005840804 6:29743591-29743613 TAGTAAAGGCGGCTGTGATCTGG - Intergenic
1006072565 6:31507926-31507948 TAGTAAAGGTGGCTGTGATCTGG + Intronic
1006083688 6:31581693-31581715 GAGAACAGGGCGCAGGGATGGGG + Intronic
1006155736 6:32011941-32011963 GAGAAACGGGGGCAGGGAGGGGG - Intergenic
1006162067 6:32044795-32044817 GAGAAACGGGGGCAGGGAGGGGG - Intronic
1006342374 6:33453583-33453605 GAGAAAAGGGGACAGTGAGGGGG - Exonic
1007432357 6:41784043-41784065 GAGAAGAGGTGGCAATGATGAGG + Intronic
1009989263 6:70821067-70821089 GAGAAAATGGGGCAGGGAGGGGG - Intronic
1010830260 6:80518781-80518803 AAGAAAATGGGGCAGTGATGTGG - Intergenic
1013681579 6:112529987-112530009 GACAAACGAGGGCAGTGATCTGG + Intergenic
1015105898 6:129536521-129536543 GAGAAAGTGGGGCAATGATAGGG - Intergenic
1015785269 6:136916748-136916770 GATATAAGGGAGCAGTGATGAGG - Intergenic
1018836461 6:167487864-167487886 GAAAAAAGGGAGCATTCATCAGG - Intergenic
1019258821 7:68614-68636 GAGAAAAGGGGGCCATGAAAAGG + Intergenic
1019376737 7:696855-696877 GAGAAAGGGGGACAGCGAGCAGG + Intronic
1019381862 7:727920-727942 AAGGAAAGGGGGCAGCTATCAGG - Intronic
1019731624 7:2632316-2632338 GAGAGGAGGGGGCCGTGACCTGG - Intronic
1021623715 7:22572453-22572475 GACAAAACGGGGCTGTGATTTGG + Intronic
1024156097 7:46627066-46627088 GAAAAAAGGAGGGAGTGATGAGG + Intergenic
1025934304 7:66022376-66022398 GAGAAAAGTTGGCAGGGATGTGG + Intergenic
1026661929 7:72309964-72309986 GTGAACAGGGTGCAGTGCTCAGG - Intronic
1026896635 7:74013384-74013406 GAGAATAGGGGGCTGGGAGCAGG + Intergenic
1027111805 7:75445924-75445946 GAGATGAGGAGGCAGAGATCAGG + Intronic
1027159209 7:75790089-75790111 GAGAAAAGGAGGGAGAGAGCTGG - Intergenic
1027284035 7:76630455-76630477 GAGATGAGGAGGCAGAGATCAGG + Intergenic
1029974793 7:104822842-104822864 AAAAAAAGGGGGCAGTGGGCTGG + Intronic
1030153389 7:106427760-106427782 GAGTGAAGGGGGCAGGGATATGG - Intergenic
1031963415 7:128009902-128009924 GAGAAAAGGAGGCAAGGATAAGG - Intronic
1031990059 7:128191705-128191727 GAGAAAAGTGGGGAGTGAAGGGG - Intergenic
1032750636 7:134836952-134836974 GAGAAAAGGCTGCAATGATTAGG + Intronic
1037580111 8:20239984-20240006 GAGAAAAGGTTGCAGGGAGCTGG + Intergenic
1039385873 8:37135096-37135118 AGGCAAAGGGGGCAGTTATCCGG - Intergenic
1039759418 8:40558445-40558467 GAGAAAAGGGGGCAGATTTGAGG + Intronic
1039804684 8:40987882-40987904 GAGATAAGGGGGCAATGATGTGG - Intergenic
1040685920 8:49873064-49873086 GGGAGGAGGGTGCAGTGATCAGG - Intergenic
1041087491 8:54270326-54270348 GTGAGCAGGGGGCAGTGAGCAGG + Intergenic
1042627431 8:70773664-70773686 GTTAAAAGGGGGAAGTGTTCAGG + Intronic
1043778566 8:84302395-84302417 GAGAAAAGAGGGACGTGAGCAGG - Intronic
1044371606 8:91418735-91418757 GAGAGAAGGGGCCAGAGATAAGG + Intergenic
1044526086 8:93252710-93252732 GAGATAAGGGAGCAGAGATCTGG + Intergenic
1046439646 8:114241210-114241232 GAGAAAAGGTGGCTTTCATCAGG + Intergenic
1047160416 8:122371573-122371595 GAGAATATGGGGCAGTGTTCAGG + Intergenic
1047225896 8:122955219-122955241 GAGAAATGGGGGCAGTGGCAGGG + Intronic
1047956684 8:129981873-129981895 GAGAGAGGGGGACAGTGGTCGGG - Intronic
1048216656 8:132501816-132501838 TAGAAAAGGGGGCAGGTCTCTGG - Intergenic
1048348998 8:133600593-133600615 GAGAACAGGCTGCAGAGATCAGG - Intergenic
1049305897 8:141903808-141903830 TAGGAATGGGGGCAGTGAGCGGG + Intergenic
1050785397 9:9394844-9394866 GAGTAGAGTGGGCAGGGATCTGG - Intronic
1051883450 9:21864617-21864639 TAGCGAAGGGGGCAGTGAACAGG - Exonic
1054465638 9:65491537-65491559 GAGGAGAGGCGACAGTGATCGGG - Intergenic
1056646572 9:88417411-88417433 GAGAAATGGGGGCAGTCTTGTGG - Intronic
1057717100 9:97503285-97503307 AAGAAGAGGGGGCATTGATCGGG - Intronic
1058709521 9:107667291-107667313 GAGAGAAGGGGAAAGTGATTAGG - Intergenic
1058915103 9:109557941-109557963 GAGAACAGGGGGCAGGAATTTGG + Intergenic
1059212628 9:112528121-112528143 GAGACATGGGGGCAGGGATTAGG - Intronic
1059774912 9:117465103-117465125 GAGGAAAGGGGGAGGAGATCTGG + Intergenic
1060216697 9:121742743-121742765 GAGAAAAGCGGGCAGTCAGAGGG - Intronic
1061226626 9:129284368-129284390 GAGAAAAGGGCCCAGGAATCAGG + Intergenic
1061501834 9:131008559-131008581 GAGTAAAGGGGGCATTTATGGGG + Intergenic
1062091006 9:134678859-134678881 GGGAAGAGGGAGCAGGGATCAGG + Intronic
1185466379 X:357182-357204 GAGAAAAGAGGGGAATGATGAGG + Intronic
1187863918 X:23706751-23706773 GAGAATAAGGAGCAATGATCAGG + Intronic
1192623850 X:72707512-72707534 GAGAAAAAGGGGCAGAGGCCAGG + Intronic
1196466732 X:115979507-115979529 GAGAAAAGTGGTAAGTGATGAGG - Intergenic
1197287888 X:124617442-124617464 GAGGAAAGGGGGCAGGGAAGAGG + Intronic
1197715713 X:129704778-129704800 GAGAAAAGGGTGAAGGGATGGGG - Intergenic
1197798918 X:130328702-130328724 GAGATGAGGGGACAGTGATGAGG - Intergenic
1201340135 Y:12924931-12924953 GAGAAAAGGAGGCAGAGGTGAGG - Intergenic