ID: 999712939

View in Genome Browser
Species Human (GRCh38)
Location 5:154334443-154334465
Sequence TAGGCTGGCAGACCTGTCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999712939 Original CRISPR TAGGCTGGCAGACCTGTCCC CGG Intronic
901436495 1:9250169-9250191 TAGGCTGCCACTGCTGTCCCGGG + Intronic
901632850 1:10656357-10656379 TAGGCTGGCTGGCATGGCCCTGG + Intronic
902629861 1:17698351-17698373 CAGGCTGGCAGCCATGTCCCAGG + Intergenic
903648101 1:24906706-24906728 CAGGGTGGGAGACCTTTCCCAGG + Intronic
904627522 1:31815324-31815346 TAGGTGGACAGACATGTCCCAGG - Exonic
904932515 1:34100926-34100948 TAGGCTGGCTGACCTCTCTCAGG + Intronic
905280437 1:36845815-36845837 TTGGCTGGGAGAACTATCCCAGG - Intronic
907310143 1:53534443-53534465 CAGGCTGGCAGAGCAGACCCTGG + Intronic
907922925 1:58929926-58929948 TAGGTAGGCAGCCCAGTCCCTGG + Intergenic
912758714 1:112346907-112346929 TAAGCTGCAAGACCTTTCCCTGG + Intergenic
914955130 1:152155184-152155206 TAGACTGGAATCCCTGTCCCTGG + Exonic
915899561 1:159836627-159836649 TAGGATGTCAGCCCTGTCCAAGG + Exonic
918142810 1:181732896-181732918 CTGGCTGGCAGACCTGCTCCGGG - Exonic
920097930 1:203498671-203498693 CAGGTGGGCAGACCTGGCCCAGG - Exonic
920228022 1:204451940-204451962 TAGGTTGAAAGACCTGCCCCAGG + Intronic
920337424 1:205254534-205254556 TTGCCTGGCAGACATCTCCCTGG + Intronic
921171238 1:212551692-212551714 TAGGATACCACACCTGTCCCTGG - Intergenic
924257522 1:242197149-242197171 TGGGCTGGCTGAGCTGCCCCAGG - Intronic
1065367022 10:24946559-24946581 ATGGCTGGCAGGCTTGTCCCAGG - Intronic
1065864095 10:29898540-29898562 TAGACTAGCAGACAGGTCCCAGG + Intergenic
1067773400 10:49143977-49143999 CAGGCTGAGAGACCTGTCCAGGG - Intergenic
1069076735 10:64045117-64045139 TGGGCTAGCAGGCCTGTCCAGGG - Intergenic
1069628327 10:69881611-69881633 CAGGCTGGCAGACATGTCAGGGG + Intronic
1069895325 10:71676974-71676996 GAGGCTGGTAGACATCTCCCAGG - Intronic
1077184986 11:1231881-1231903 ACGGCTGGGAGCCCTGTCCCAGG - Intronic
1077445661 11:2589436-2589458 TTGGATGGCAGACCTGTCTAGGG + Intronic
1078430208 11:11282479-11282501 GAGGCTGGGAGACTTGTCCAGGG + Intronic
1081713965 11:45235484-45235506 TCTACTTGCAGACCTGTCCCTGG + Intergenic
1083937270 11:65876447-65876469 GAGGCTGAGAGACTTGTCCCAGG + Intergenic
1084557817 11:69885366-69885388 TAGGCAGCCACTCCTGTCCCAGG - Intergenic
1084589432 11:70081819-70081841 TGTCCTGGAAGACCTGTCCCAGG - Intronic
1085624775 11:78063693-78063715 AAGGCTGGCAGATCTGTCTCTGG + Intronic
1087083576 11:94195028-94195050 TGAGCTGGCAGCCCTGGCCCGGG - Intergenic
1089381679 11:118037254-118037276 TAGGCTAGCAGGCCGGTCCAGGG + Intergenic
1089679851 11:120113251-120113273 AAGGCTGGGAGAGCTGTCACTGG - Intronic
1091285171 11:134404912-134404934 CAGGCTGGCAGAGCTGGGCCGGG + Intronic
1093275934 12:17126758-17126780 TAGGCTGGAAGCCCTATTCCAGG + Intergenic
1095798218 12:46244316-46244338 TAGGCTGCCAGTACTGTCCTTGG - Intronic
1098659714 12:73076470-73076492 GAGGCTGGCAAACCTGCCACAGG - Intergenic
1102528444 12:113528715-113528737 TTGGCTGTAAGCCCTGTCCCTGG - Intergenic
1107625056 13:42273298-42273320 TAGGATGGCAGCCCAGTGCCTGG + Intronic
1108532641 13:51341946-51341968 TAAGCTGGCAGATCTGGCACTGG - Intronic
1108703726 13:52966071-52966093 GCTTCTGGCAGACCTGTCCCTGG + Intergenic
1110086166 13:71383296-71383318 TAGGCTGGTAGACCTTACCAGGG + Intergenic
1110852670 13:80262893-80262915 CAGGCTGGAAAACCTGCCCCAGG + Intergenic
1114416395 14:22547554-22547576 TAGGCAGACAGACTTGTCACTGG - Intergenic
1114554173 14:23551886-23551908 TGGGCTGGCCGGCCTGCCCCCGG - Intronic
1114746608 14:25155151-25155173 TAGGAAGGCAGAACTGACCCTGG - Intergenic
1118175447 14:63435475-63435497 TAGGCTGGCAGATATAACCCAGG - Intronic
1122455424 14:101846676-101846698 AGGGCTGGCAGGCCTGTACCGGG + Intronic
1127374785 15:58374475-58374497 TTTGCTGGCAGAGCTGGCCCAGG + Intronic
1132117928 15:99151183-99151205 GATGCTGGCAACCCTGTCCCAGG + Intronic
1132317229 15:100898945-100898967 TAGCCTCCCAGACCTGTCCACGG + Intronic
1134091430 16:11393589-11393611 GAGCCTGGCCCACCTGTCCCTGG + Intronic
1134911572 16:18031566-18031588 TGGGCTAGCAGACCAGTCCAGGG + Intergenic
1135078002 16:19410800-19410822 TAGGCTGGCAGCCCGGGCGCTGG - Exonic
1135417584 16:22280380-22280402 GGGCCTGGCAGACCTGCCCCTGG + Intronic
1141158451 16:81612834-81612856 TGGGCTGGGGGACCTTTCCCAGG + Intronic
1143510571 17:7393336-7393358 TAGGCTGGGAGACCTGTAATCGG - Exonic
1144166751 17:12619481-12619503 GAGGCAGGCAGAGCTGTCCCAGG - Intergenic
1144731301 17:17527980-17528002 TAGGCTGGGAGCCCTGGGCCAGG - Intronic
1144769078 17:17749188-17749210 GAGGCGGGCAGGACTGTCCCTGG - Intronic
1146770925 17:35568099-35568121 TAGGCTGTAAGACCTGAGCCGGG + Intergenic
1147554399 17:41467196-41467218 TGGGCTGGCAGACATAGCCCAGG + Exonic
1151226967 17:72655014-72655036 TGGGCTGGCAGCCCCGTGCCAGG - Intronic
1154284254 18:13036710-13036732 TAGGCTGGCGTTCCTTTCCCAGG + Intronic
1157246756 18:46061500-46061522 TTGGCTGGCAGGCCTCTCCCTGG - Intronic
1160418723 18:78729515-78729537 TAAGCTGCCAGACCAGGCCCCGG - Intergenic
1161356621 19:3822814-3822836 GGAGCTGGCAGACCTGGCCCAGG + Intronic
1162447226 19:10730944-10730966 GAGGCCAGCAGAGCTGTCCCAGG + Intronic
1163126033 19:15244639-15244661 CAGGCAGGCAGAACTGGCCCGGG + Intronic
1163831039 19:19547295-19547317 TGGGATGGGAGACTTGTCCCTGG + Intergenic
1165077750 19:33290259-33290281 GAGGCTGCCAAACCTGTGCCGGG + Intergenic
1166372392 19:42309593-42309615 AAGGCTGGGAGACTGGTCCCTGG - Exonic
1166976779 19:46609532-46609554 GTGGCTGCCAGCCCTGTCCCGGG + Exonic
1168577965 19:57528711-57528733 TAGTCTGGCTGACCTTTCTCTGG - Intronic
925193964 2:1908426-1908448 TAGGTGGGCAGAGCAGTCCCCGG + Intronic
925413744 2:3655365-3655387 CAGGCTGGCACATGTGTCCCAGG + Intergenic
926008280 2:9389492-9389514 GAGGCCGGGAGACCTGGCCCAGG + Intronic
933348919 2:81127907-81127929 TAGTCTGGCAGAACTTTCCATGG - Intergenic
937290668 2:120779819-120779841 GAGGCTGCCAGTCCTGGCCCGGG - Intronic
939987880 2:148849974-148849996 TAGGATGGAGGACCTGTGCCAGG - Intergenic
941645222 2:168033057-168033079 TATGTTGGCAGACCTGTGCCAGG - Intronic
942679577 2:178463050-178463072 TGGGCTGGGAGACCGGTCCGGGG - Intergenic
944172023 2:196789921-196789943 TAGACTGGCAGAAATGTCTCTGG - Exonic
945043781 2:205764316-205764338 TAATCTCCCAGACCTGTCCCAGG + Intronic
945804936 2:214478849-214478871 TAGGCTGCCTTACCTTTCCCAGG + Intronic
947743609 2:232496583-232496605 GAGGCTTGCAGACCTTTGCCCGG + Intergenic
948883927 2:240873720-240873742 TGGGGTGGCAGGGCTGTCCCTGG + Intronic
949075897 2:242057710-242057732 GAGGCTGGCAGGCCTGGCCGGGG + Intergenic
1170742127 20:19067300-19067322 TCTGCTTGCAGACCTGCCCCAGG - Intergenic
1172216057 20:33236644-33236666 TTGGCTTGCAGACCTCTCACAGG - Intronic
1173010475 20:39177120-39177142 TGGGCTTCCAGACCAGTCCCTGG - Intergenic
1173582198 20:44155158-44155180 TATGCTGGCTGCCCTGTGCCAGG + Intronic
1173658982 20:44720055-44720077 CGGGCTGGCAGACCAGGCCCTGG - Exonic
1173760885 20:45559496-45559518 TAGTCAGGCAGACCTGGCTCGGG + Intronic
1175163986 20:57030040-57030062 TGGACTGGCAGACCTGTCTGCGG + Intergenic
1176127401 20:63482177-63482199 TGGGCTGGCAGTTCTGCCCCAGG - Intergenic
1179306791 21:40161189-40161211 CAGGCTGGCAGCTCTGTCCTGGG + Intronic
1180174936 21:46082839-46082861 GAGGCTGGGTGACCAGTCCCTGG + Intergenic
1181038602 22:20181609-20181631 CAGGCTGGCAGAGCAGCCCCAGG + Intergenic
1184971966 22:48029225-48029247 TACACCCGCAGACCTGTCCCAGG - Intergenic
1185189679 22:49427373-49427395 TAGCCAGGGACACCTGTCCCAGG - Intronic
949336282 3:2978804-2978826 GAGGATGGCAGAGCTGTCACAGG - Intronic
950142891 3:10627528-10627550 GAGGCTGGGAGAACTGGCCCAGG - Intronic
954419388 3:50410583-50410605 TGGGCTGGCAGGCCTGGGCCAGG - Intronic
954453944 3:50586812-50586834 CAGGCAGGCAGGCCTGTTCCTGG - Intergenic
961430116 3:126875328-126875350 AAGGCAGGCAGCCCTTTCCCTGG - Intronic
961449234 3:126994995-126995017 AAGCCTGGCAGGCCTGCCCCTGG - Intronic
962357878 3:134710280-134710302 AAGGCTGGCTGGCCTCTCCCTGG + Intronic
965047546 3:163598290-163598312 TAGTCTGGCAGCACTGTCCTTGG + Intergenic
969629873 4:8329904-8329926 CAGGCTGGCAGACCTGGGCGGGG + Intergenic
973739401 4:53904618-53904640 TTGGCTGGGAGACCTGGTCCAGG - Intronic
974408111 4:61502215-61502237 TGGGCTGGGAGATCTGTTCCTGG + Intronic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
982189976 4:152843812-152843834 TAGGCTTGAAAACCTGACCCAGG + Intronic
985580411 5:692998-693020 GACGGTGACAGACCTGTCCCTGG + Intronic
985708471 5:1414967-1414989 CAGCCTGGCAGAGCTGTCCTTGG + Intronic
986269521 5:6218597-6218619 TAGCCTGGCAGCTCTGGCCCTGG + Intergenic
992920328 5:81510199-81510221 TAAGCTGATAGACCTGTCCTAGG - Intronic
994095821 5:95846613-95846635 CAGGAGGGCAGACCTTTCCCTGG - Intergenic
994959374 5:106579039-106579061 TAGCTTGCCAGACCTGGCCCTGG - Intergenic
998003400 5:138641755-138641777 TAGGCTGTCATACCTGGGCCTGG - Intronic
999712939 5:154334443-154334465 TAGGCTGGCAGACCTGTCCCCGG + Intronic
999999056 5:157120276-157120298 TAGTCTGGCAGTCCTGCCCCCGG + Intronic
1000997761 5:167975583-167975605 TAGGCAGGCAGACATGTCACAGG + Intronic
1001450871 5:171823355-171823377 TAGGCTCACACACCTGCCCCTGG + Intergenic
1002925014 6:1600880-1600902 GAGGCGGGCAGACGTGTCACTGG - Intergenic
1003544100 6:7043969-7043991 TAGGCAGGCAGGCCAGACCCAGG + Intergenic
1003558433 6:7161208-7161230 TAAGCAGGCTGACCTCTCCCAGG - Intronic
1003874010 6:10421351-10421373 GGGGCTGGCAGACGTGTCCCAGG + Intergenic
1004556052 6:16699618-16699640 TAGGTTGGCTTACCTCTCCCTGG - Intronic
1006523415 6:34585267-34585289 AAGGATGGCAGAGCTCTCCCAGG + Intergenic
1007610675 6:43146897-43146919 GAGGTTGTCTGACCTGTCCCAGG + Intronic
1011765092 6:90611331-90611353 GAGGCTGGGAGACCTGCCCGTGG - Intergenic
1015959481 6:138632074-138632096 TAGTCTGGCAGTACTGTCCGTGG + Intronic
1017811718 6:157988498-157988520 TATTCAGGCAGACCTGTCCTGGG + Intronic
1017978347 6:159376975-159376997 TAGGCAGGCAGCCCTGCCCTGGG + Intergenic
1018526359 6:164714034-164714056 TTGGCTGGCACACTTCTCCCAGG - Intergenic
1020881049 7:13763816-13763838 TAGTGTCCCAGACCTGTCCCAGG - Intergenic
1024248834 7:47491094-47491116 GAGGCGGGCAGACATGACCCAGG + Intronic
1026982590 7:74535592-74535614 TGGGCCAGCACACCTGTCCCAGG + Intronic
1027052469 7:75028823-75028845 GAGGCTTGCAGGCCTGACCCTGG + Intronic
1032541954 7:132710688-132710710 GAGGATGGTAGATCTGTCCCAGG - Intronic
1032781575 7:135168701-135168723 TAGGCTGGAAGACCTGGCCCAGG + Intronic
1034495628 7:151420260-151420282 TGGGCTGGGAGAACTGTGCCAGG - Intergenic
1035275279 7:157744722-157744744 CAGGCAGACAGACCTGTCCTTGG - Intronic
1035987178 8:4447046-4447068 TAGGCTCGCAGACCTGACACAGG - Intronic
1037564406 8:20105497-20105519 TAGGCAAGCAAACCTGACCCTGG + Intergenic
1037887063 8:22600800-22600822 AAGGCTGGCAGCACTGCCCCAGG - Intronic
1040339961 8:46435464-46435486 GAAGCTGCCAGGCCTGTCCCAGG - Intergenic
1041023572 8:53661315-53661337 TGGGCTGGCGGACCTGGCCCCGG - Intergenic
1041867692 8:62595828-62595850 TGGGCTAGCAGGCCTGTCCAGGG + Intronic
1047538014 8:125737005-125737027 TGGACTGGCAGTCCTCTCCCAGG - Intergenic
1049062894 8:140290016-140290038 CAGGCTGTCACATCTGTCCCAGG + Intronic
1056125967 9:83537242-83537264 TTTGCTGGCAGCCCTGTCCTCGG - Intronic
1058670821 9:107359269-107359291 TAGGCTGACAGAGCAGTCACGGG - Intergenic
1059867519 9:118532839-118532861 TAGGCTTGAAGACATTTCCCTGG + Intergenic
1061388613 9:130304881-130304903 CCAGCTGGCTGACCTGTCCCTGG + Intronic
1061782665 9:133004955-133004977 TAGGCTGGGAGACCTGCCCTGGG + Intergenic
1188113340 X:26216822-26216844 TAGCCTGGCAGCCCTGCCTCAGG - Intronic
1189603137 X:42648575-42648597 TAGGCTTGAAAACTTGTCCCAGG - Intergenic
1194055449 X:89126827-89126849 AAAGCTCCCAGACCTGTCCCAGG - Intergenic
1194488868 X:94522052-94522074 TAGGCAGGCACACCCCTCCCAGG - Intergenic
1198618827 X:138484811-138484833 TAGGCTGGCATTCATTTCCCTGG + Intergenic