ID: 999714862

View in Genome Browser
Species Human (GRCh38)
Location 5:154352498-154352520
Sequence CCCAGCTGCAGGGTTTTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 158}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999714862_999714873 28 Left 999714862 5:154352498-154352520 CCCATGAAAACCCTGCAGCTGGG 0: 1
1: 0
2: 0
3: 15
4: 158
Right 999714873 5:154352549-154352571 ACAGCTAGTAAACGGAAGCTGGG 0: 1
1: 0
2: 1
3: 9
4: 114
999714862_999714872 27 Left 999714862 5:154352498-154352520 CCCATGAAAACCCTGCAGCTGGG 0: 1
1: 0
2: 0
3: 15
4: 158
Right 999714872 5:154352548-154352570 CACAGCTAGTAAACGGAAGCTGG 0: 1
1: 0
2: 2
3: 14
4: 142
999714862_999714868 -6 Left 999714862 5:154352498-154352520 CCCATGAAAACCCTGCAGCTGGG 0: 1
1: 0
2: 0
3: 15
4: 158
Right 999714868 5:154352515-154352537 GCTGGGAGAGGTTAAGTAATTGG 0: 1
1: 0
2: 5
3: 51
4: 301
999714862_999714871 20 Left 999714862 5:154352498-154352520 CCCATGAAAACCCTGCAGCTGGG 0: 1
1: 0
2: 0
3: 15
4: 158
Right 999714871 5:154352541-154352563 AAGATCGCACAGCTAGTAAACGG 0: 2
1: 16
2: 140
3: 762
4: 2590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999714862 Original CRISPR CCCAGCTGCAGGGTTTTCAT GGG (reversed) Intronic
903682739 1:25108004-25108026 TCCAGCTGCAGGGCTATGATTGG + Intergenic
911043879 1:93612998-93613020 CCCTGCTGCAGCCTTTTCAAAGG + Intronic
911213916 1:95171320-95171342 CCGGGCTGCAGGATTTTCAGTGG - Intronic
912041481 1:105396852-105396874 GCCAGCTGAAGTCTTTTCATGGG + Intergenic
915183243 1:154081684-154081706 CCCAGCTCCAGCGTTTTATTGGG - Intronic
917378418 1:174376731-174376753 GTTAGCTGCAGGTTTTTCATAGG - Intronic
918116282 1:181500798-181500820 CACAGTTGCAGAGTTTTCAGAGG + Intronic
921320183 1:213931101-213931123 CCCAGCTGCAGGGGTGCCACTGG + Intergenic
921791463 1:219295275-219295297 CCCAGCTCCATGGTTCTCAATGG - Intergenic
923373982 1:233341520-233341542 CCCAGGTCCAGAGTTTCCATAGG - Intronic
924259299 1:242213080-242213102 CCCTGCTGAAGGGGTTTCATAGG - Intronic
1063648214 10:7907248-7907270 CCCTTCTGCAGGGCTGTCATTGG + Intronic
1064295670 10:14076956-14076978 CCAAGCTGGAGGGTTCTCAAGGG + Intronic
1066470349 10:35691693-35691715 CTCAGCTGCACGAGTTTCATGGG + Intergenic
1067049049 10:43001509-43001531 CCCAGCTGCAAGGTTGTCAGAGG + Intergenic
1069809913 10:71150716-71150738 GCCAGCTGCAGAGGCTTCATAGG + Intergenic
1070514400 10:77190400-77190422 CATAGCTGCAGGGTCTTGATTGG - Intronic
1073562580 10:104509541-104509563 CCCACCTTCAGAGTTTCCATGGG - Intergenic
1079191959 11:18286005-18286027 ACCGCCTGCAGGTTTTTCATGGG - Intronic
1085286258 11:75363678-75363700 CCCAGATGCGGGGGTTTCCTGGG + Intergenic
1086669604 11:89530992-89531014 CCCAGCTGCAATCTTCTCATTGG + Intergenic
1087035798 11:93755271-93755293 TCCATCTGCAGGGTTCACATGGG - Exonic
1087987494 11:104702329-104702351 GTCAACTGCAGGTTTTTCATAGG + Intergenic
1089654859 11:119939922-119939944 CTCAGCTGTGTGGTTTTCATTGG - Intergenic
1090418098 11:126554833-126554855 GCCAGCTGAAGTCTTTTCATGGG - Intronic
1090767193 11:129886347-129886369 CCCAGCAGCAGTATTTCCATCGG - Exonic
1091751862 12:3027333-3027355 TCCAGCTGGAGGGTTTTCTTTGG + Intronic
1091840036 12:3614153-3614175 CCCAGCTGCAGGAATCTCACGGG + Intronic
1092546945 12:9460527-9460549 CCAAGCGGCTGGGTTTTCATTGG + Intergenic
1093194627 12:16115471-16115493 TCCAGCTCCAGGACTTTCATGGG + Intergenic
1094505994 12:31061545-31061567 CCAAGCTGCTGGGTTTTCACTGG - Intergenic
1095414868 12:41965513-41965535 CCCAGCTGCAGAGCTCTCACGGG + Intergenic
1095734703 12:45543944-45543966 CCCAGCTTCAAGCTCTTCATGGG - Intergenic
1100204326 12:92331576-92331598 CCCAGCTGCAGGGCAATCAAAGG - Intergenic
1100491586 12:95085010-95085032 CCCTACAGCAGTGTTTTCATAGG + Intronic
1101260688 12:103026698-103026720 CCCAGCTCCAGAGCCTTCATTGG + Intergenic
1101260862 12:103028202-103028224 CCCAGCTCCAGAGCCTTCATTGG - Intergenic
1103953467 12:124564655-124564677 CCCAGCCGGAGGGTTCTCCTGGG - Intronic
1104982051 12:132577498-132577520 CCCAGCTGCGGTGGTTTCCTAGG + Intronic
1106951739 13:34892133-34892155 GCCAGTTCCAGGGTTTTAATTGG - Intergenic
1109851569 13:68072158-68072180 CTCAGCTGAATTGTTTTCATTGG + Intergenic
1111280882 13:86022945-86022967 CCAAGGTGCAGTGCTTTCATCGG + Intergenic
1112366842 13:98762495-98762517 CCCAGCTTCAGCGTTTGCAGAGG + Intergenic
1113740686 13:112710606-112710628 CTGAGCTGCTGGGTTTTCCTGGG + Intronic
1113854569 13:113436447-113436469 CCCAGGTGCAGGGTGAACATAGG + Intronic
1113854621 13:113436615-113436637 CCCAGGTGCAGGGTGAACATAGG + Intronic
1113854660 13:113436741-113436763 CCCAGGTGCAGGGTGAACATAGG + Intronic
1119808985 14:77500357-77500379 CACAGCTGCAGGGTTTTGAATGG + Intergenic
1122853049 14:104547071-104547093 TCCAGATGCAGGGTCCTCATGGG + Intronic
1122979426 14:105185014-105185036 CCCAGCTGCTGGGTTGGCAGTGG - Intergenic
1124823898 15:33074410-33074432 AACAGCTGCAGGCTTTTGATGGG - Intronic
1127832064 15:62759722-62759744 CCCAGCTGAAGGGGTATGATTGG + Intronic
1129281786 15:74490871-74490893 CCCAGCTGCTGGGATATAATAGG - Intergenic
1132678237 16:1129463-1129485 CCCTGCTGCGGGGTTTTCCTGGG + Intergenic
1134664683 16:16010341-16010363 CCCAGCTGCAGTCTTTGGATGGG + Intronic
1136688921 16:32014141-32014163 CCTAGCTACAGATTTTTCATAGG - Intergenic
1136789516 16:32957651-32957673 CCTAGCTACAGATTTTTCATAGG - Intergenic
1136880296 16:33896279-33896301 CCTAGCTACAGATTTTTCATAGG + Intergenic
1138180640 16:54938219-54938241 CCCAGGTGCAGGGTTATTAGGGG + Intergenic
1138474120 16:57260663-57260685 CCCAGCTGCAGGGGTTTTCCGGG + Intronic
1139289052 16:65840726-65840748 CCCTGCTGTAGGGATTTCCTTGG - Intergenic
1141819306 16:86434087-86434109 CCCAGCTGGTTGGTTCTCATGGG - Intergenic
1203091716 16_KI270728v1_random:1219125-1219147 CCTAGCTACAGATTTTTCATAGG - Intergenic
1144305437 17:13965838-13965860 GCCAGCTGAAGTCTTTTCATGGG + Intergenic
1147151769 17:38520302-38520324 CCTAGCTACAGATTTTTCATAGG - Intergenic
1148209302 17:45798697-45798719 CCCTGCTGCAAGGTTTTCTTAGG + Intronic
1149304579 17:55335502-55335524 CCCAGCCTCAGGGTTCTCAGTGG + Intergenic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
1152087658 17:78230602-78230624 CCCAGCTGCAGTGTGTTTAGGGG + Intergenic
1156658207 18:39312578-39312600 TGCACCTGCAGGGTTTACATAGG - Intergenic
1157436056 18:47670246-47670268 CACAGGTGCATGTTTTTCATGGG - Intergenic
1157530800 18:48418936-48418958 CCCAGCCTCTGGGTTTTCCTTGG - Intergenic
1166633081 19:44425144-44425166 CCCAGCTGCTAGGATTTCAGTGG - Intronic
925020518 2:564432-564454 CCCAGCTGCAAGCTTTTCCGTGG + Intergenic
929885144 2:45871621-45871643 AACAGCTGAAGGGTTTACATGGG + Intronic
932830601 2:74986124-74986146 GACAGCTGCAGGGTCCTCATGGG - Intergenic
933164305 2:79058854-79058876 CACAGCTTTAGGTTTTTCATAGG + Intergenic
933809067 2:86021226-86021248 GCCCGCTGCAGTGTTTTCACGGG - Exonic
937539060 2:122926009-122926031 GCCAGCTGAAGTCTTTTCATGGG + Intergenic
939421405 2:141975417-141975439 ACCAGCTGCAGAGTTTTAAAAGG - Intronic
941853202 2:170204994-170205016 CCCACCAGCAAGGTTTTCAAGGG - Intronic
941887036 2:170538666-170538688 CCCAGCAGAAGGGTTCTCAACGG + Intronic
944968585 2:204965201-204965223 CCGATCTGCAGGGTTTCCACTGG - Exonic
946961718 2:224992476-224992498 CCCAGCTCCAGGGTTTTGAAAGG + Intronic
947058064 2:226130328-226130350 GCCAACTGGAGGGTTTTCAGAGG - Intergenic
948290962 2:236824121-236824143 CCCACCTCCAGGGCTTTCTTAGG - Intergenic
948696460 2:239735421-239735443 ACCAGCTGCAGGCTTTTCGCAGG - Intergenic
1168841251 20:911394-911416 GCCAGCTGCAGGGTGGGCATTGG + Intronic
1168913280 20:1466917-1466939 CCCAGCTGCTGGGCCCTCATCGG - Exonic
1172123678 20:32612861-32612883 GCCAGCTGCAGGGCTTCCTTGGG + Intergenic
1177072954 21:16533913-16533935 CCCAGTTGCAGGGTTTTATGTGG + Intergenic
1178552084 21:33549767-33549789 CACAACTGCAGGGGATTCATTGG - Exonic
1180745369 22:18085071-18085093 CACAGCTTCAGGGATGTCATGGG - Intronic
1182166547 22:28180066-28180088 CCTGATTGCAGGGTTTTCATGGG + Intronic
1182630676 22:31682890-31682912 GCCAGCTGCAGTGTTGTCAGGGG - Exonic
1184172468 22:42768104-42768126 ACCAGCTGGACGGTTTTCCTGGG + Intergenic
1184482559 22:44756358-44756380 CCCAGCTGCAGGGGCCTCAGAGG - Intronic
1184675675 22:46041700-46041722 CCCACCTGCAGGGTGTTCTGAGG - Intergenic
1185144242 22:49121338-49121360 CACTGCTGCAGGGGTTTCCTGGG + Intergenic
1203244604 22_KI270733v1_random:53361-53383 CCCAGATTCAGGTTCTTCATTGG + Intergenic
949910954 3:8907550-8907572 GCCAGCTGAAGTGTTTTTATGGG - Intronic
950026075 3:9820739-9820761 CCCAGCTGCAGGGGACTCACTGG - Exonic
950575866 3:13831761-13831783 CCCAGCTCCAGGTTTCTCATGGG + Intronic
951835132 3:26974819-26974841 CCTATCTGCAGGGTTTTTTTGGG + Intergenic
952000717 3:28782711-28782733 ACCATTTGCAGGGTTTTCTTGGG - Intergenic
954292681 3:49658080-49658102 GACCGCTGCAGGGTCTTCATGGG - Exonic
956752953 3:72359329-72359351 GCCAACTGTAGGTTTTTCATAGG + Intergenic
961481105 3:127181480-127181502 ACCAGCTCCAGTGTTATCATGGG - Intergenic
962456968 3:135573638-135573660 CCCAGCTGCAGGGAGTTCAAGGG + Intergenic
964188210 3:153972724-153972746 CCCAGCTGCCTGGTTTTCTTTGG - Intergenic
964494698 3:157275738-157275760 CCCAGAAGCAGTGTTTTCAAGGG - Intronic
968876741 4:3272437-3272459 GTCAGCTGTAGGTTTTTCATAGG + Intergenic
969860877 4:10034426-10034448 CACAGCCGCAGGGTTTGCCTTGG + Intronic
970089753 4:12391730-12391752 CACAGCTCCAGTGTTTTCCTGGG + Intergenic
970775891 4:19673716-19673738 CTCACCTCCAGGCTTTTCATAGG - Intergenic
972431103 4:38983049-38983071 CAAAGCTGCAGGGTAGTCATAGG + Intronic
972681655 4:41312116-41312138 GCCAGCTGCAGTCTTTTTATGGG - Intergenic
973197044 4:47456586-47456608 CACAGCTACAGGATTTTGATTGG - Exonic
973300550 4:48578287-48578309 TCCAGATGCTGGGTTTACATGGG + Intronic
976145750 4:82041553-82041575 CCCTGCTGCACCATTTTCATAGG - Intronic
981323916 4:143425248-143425270 GACATCTGCAGGGTTTTCAACGG - Intronic
981893699 4:149770793-149770815 ACTAGCTGTAGGTTTTTCATAGG - Intergenic
984839643 4:184056596-184056618 CACAGCTGCAGGTCTTTCTTGGG + Intergenic
987417983 5:17684459-17684481 CCGATCTGCAGGGTTTTCTCTGG + Intergenic
989243412 5:39225987-39226009 CCCAGCTGCAGGCCTCTCATGGG + Intronic
991381960 5:66037603-66037625 ACTAGCTGGAAGGTTTTCATAGG + Intronic
991533255 5:67638381-67638403 CTGAGCTGGAGGGTTGTCATTGG - Intergenic
997624655 5:135323712-135323734 CCCAGATGCATGATTTTCATGGG - Intronic
999714862 5:154352498-154352520 CCCAGCTGCAGGGTTTTCATGGG - Intronic
1000334168 5:160229549-160229571 CCCAGCAGCATGGCTTTCACCGG + Exonic
1002076641 5:176712375-176712397 CCCAGCTGCAGGGATTAAAGGGG + Intergenic
1003427263 6:6006170-6006192 CCTAGCTGCAGCGTTTGCACGGG - Intronic
1004528599 6:16432373-16432395 CTCATTTGCATGGTTTTCATTGG + Intronic
1006925766 6:37654422-37654444 CCCAGCTGCAGTGGTCCCATGGG - Exonic
1007229046 6:40335444-40335466 CCCAGCTGCAGAAATTTCAGTGG + Intergenic
1008583091 6:52923805-52923827 CTCAGCTTCAGCGTTTTCAGAGG + Intergenic
1009418467 6:63440722-63440744 CCTGGCTCCAGGGTTTTGATGGG - Intergenic
1010202049 6:73290610-73290632 CACATCAGCAGGGTTTTCAATGG - Intronic
1013666683 6:112356505-112356527 GACATCTGCAGGGTTTTCAATGG + Intergenic
1017286937 6:152686298-152686320 GCCAGCTGAAGTCTTTTCATGGG + Intergenic
1018966738 6:168495777-168495799 CCCACCTGCAGGGTTCACCTGGG + Intronic
1019364973 7:628590-628612 CCCAGCTGTGTGGTTTTCCTGGG - Intronic
1019579819 7:1755957-1755979 CCCCTCTGGAGGGTTTTCCTCGG - Intergenic
1019744594 7:2692607-2692629 TCCAGCTTCAGGGGTTTCCTGGG + Intronic
1021006325 7:15398426-15398448 CCCAGCTCCAAGGTACTCATAGG - Intronic
1022660044 7:32358406-32358428 TCAAGCTGCAGTGTGTTCATTGG + Intergenic
1024189658 7:46993185-46993207 CCCAGCCCCAGGGTTTCCACTGG - Intergenic
1024580580 7:50797276-50797298 CCCAGGTGCAGGCTTCTGATTGG - Intergenic
1025144494 7:56492525-56492547 CCCTACTGCTGGGTTTTCAGTGG + Intergenic
1026009667 7:66627383-66627405 CCCAGCTGCAGGAGTGTCCTAGG - Intergenic
1028219567 7:88181158-88181180 CCCAGCAGCAGAGTTATAATGGG - Intronic
1033063161 7:138127286-138127308 CCTAGATCCAGGGTTTTTATTGG - Intergenic
1033431033 7:141289764-141289786 TCAAGGTGCAGGGCTTTCATGGG + Intronic
1033826347 7:145194843-145194865 CCCAGCTCCAGGGTTCTCTGTGG - Intergenic
1035760596 8:2065988-2066010 GGCAGCAGCAGGGTTTTCAAGGG + Intronic
1036674128 8:10815576-10815598 CCCATGTGCAGAGCTTTCATTGG - Intronic
1039792307 8:40885744-40885766 TCCAGCTTCAGGGTCTTCTTGGG + Intronic
1039952390 8:42182270-42182292 CCCAGCTCAGTGGTTTTCATTGG - Intronic
1043683706 8:83063573-83063595 CCCAGTTGCAAAGTTTTCTTGGG - Intergenic
1044182770 8:89216623-89216645 CTCAGCTTCAGGGTTTTCTCTGG + Intergenic
1045237083 8:100361632-100361654 CCCTGCGGCAAGATTTTCATGGG - Intronic
1046662484 8:116963184-116963206 GACAGCTGCAGGGTTCTCACGGG - Intronic
1049673962 8:143881566-143881588 CCCAGCTCCAGGCTTCTCCTCGG - Intergenic
1050647725 9:7739687-7739709 CCTAGCTGCAGGGTGGGCATGGG - Intergenic
1055795732 9:79973022-79973044 CACAGCTGCCTGGTCTTCATTGG - Intergenic
1056748714 9:89328865-89328887 ACCAGCTGCAGTGTTATCAAAGG + Exonic
1058831905 9:108825154-108825176 CACAGCTGCAGTGTTTCCTTGGG - Intergenic
1203460938 Un_GL000220v1:36444-36466 CCCAGATTCAGGTTCTTCATTGG + Intergenic
1186459837 X:9739543-9739565 CCCGGAAGCAGGGTTTTCATGGG + Exonic
1190535325 X:51421010-51421032 CCCAGTTGCGGGGATTTCACCGG + Intergenic
1192635364 X:72810868-72810890 GCCAGCTGCAGGTTTTTTGTAGG + Intronic
1192646350 X:72909935-72909957 GCCAGCTGCAGGTTTTTTGTAGG - Intronic
1198374964 X:136029684-136029706 CCCAATTACAGGTTTTTCATAGG - Intronic
1199725864 X:150580118-150580140 GTCAGCTGAAGGTTTTTCATAGG + Intronic