ID: 999716006

View in Genome Browser
Species Human (GRCh38)
Location 5:154360488-154360510
Sequence AGAGCTCTGCTTATGTCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999716006 Original CRISPR AGAGCTCTGCTTATGTCATG TGG (reversed) Intronic
901181064 1:7342213-7342235 GGAGCTCTTCTGAGGTCATGTGG - Intronic
901755038 1:11436297-11436319 AAAGCACAGCTAATGTCATGTGG - Intergenic
902323903 1:15685860-15685882 TGAGCTTTGCTAATGTAATGGGG + Intronic
905721326 1:40205158-40205180 AGAGCTCTTCTTAGGTCCAGAGG + Intronic
906793057 1:48675289-48675311 TGAGCTCCGCTTCTGTCAAGGGG - Intronic
906808874 1:48806334-48806356 AGACCACTGCTTATGGGATGAGG - Intronic
907366325 1:53963664-53963686 AGTGCTTTGCCTATGTCTTGGGG + Intronic
907374716 1:54026601-54026623 AGGGCTTTGCAAATGTCATGGGG + Intergenic
908413872 1:63893320-63893342 AGCTCTCTGCTTACATCATGTGG + Intronic
908670344 1:66539863-66539885 AGAGCTGTGTTTATGGCTTGTGG + Intronic
910355972 1:86355578-86355600 ACAGGTCAGCTTGTGTCATGGGG + Intronic
912201542 1:107463747-107463769 AGAGCCCTGATTATGTCCTTAGG + Intronic
912586675 1:110772910-110772932 AGAGGTAAGCTTGTGTCATGGGG + Intergenic
918483899 1:185009052-185009074 AGAGCTCTGCTTGTATTATGGGG - Intergenic
919844325 1:201631665-201631687 AGTGCCCTCCTTATGCCATGGGG - Intronic
922031871 1:221809117-221809139 GGGGGTCTGCCTATGTCATGAGG + Intergenic
922083315 1:222319842-222319864 AGAGTTCTGTTTCTGTCAAGGGG + Intergenic
923847456 1:237751121-237751143 AAAGCTATGGTTAGGTCATGAGG - Intronic
1063234329 10:4096931-4096953 AGCTCTCAGCTTATGCCATGTGG + Intergenic
1063615307 10:7595043-7595065 AGATCTCTTCTGATGACATGTGG - Intronic
1064565749 10:16637202-16637224 AGTGCTCTTTTTATTTCATGTGG - Intronic
1065268815 10:24005437-24005459 ACAGCTATGTTTATGTCATTGGG + Intronic
1065485790 10:26235449-26235471 AGAGCTTTGCTTATCTGATGAGG + Intronic
1067476036 10:46566986-46567008 ACAGCTGTGTTTATGTCAAGAGG - Intergenic
1067618702 10:47774794-47774816 ACAGCTGTGTTTATGTCAAGAGG + Intergenic
1067792523 10:49298864-49298886 AGAGCCCTGCTGATGTCCCGGGG - Intergenic
1069778701 10:70941661-70941683 AGAGCTCTCCTGATGCCCTGAGG - Intergenic
1070378110 10:75854069-75854091 AGAGTTGTGGTTATGTAATGGGG + Intronic
1070669858 10:78370176-78370198 TGAGCTCTCCTTCTTTCATGGGG - Intergenic
1071547575 10:86539998-86540020 AGGGCTCTGCTTATATCCTGTGG + Intergenic
1072209878 10:93236634-93236656 AGAGCTTTGTTTCTGCCATGTGG + Intergenic
1074733736 10:116405802-116405824 AGAGCTCAGCTTATTTTATGAGG + Intergenic
1074830719 10:117246360-117246382 AATGCTTTGCTTATGCCATGGGG + Intronic
1074932089 10:118138811-118138833 AGTGCTCTGCTTATATCTTATGG + Intergenic
1075608694 10:123834691-123834713 TGACCTCTCCTAATGTCATGTGG + Intronic
1081950890 11:47041547-47041569 TGAGCTATGCTGAGGTCATGAGG - Intronic
1084328318 11:68414652-68414674 AGCTCGCTGCTGATGTCATGGGG - Intronic
1085904513 11:80743917-80743939 AGAGCTAACCTTATATCATGAGG - Intergenic
1086023809 11:82265700-82265722 AGAGCTTTCTTTATGTGATGGGG + Intergenic
1087234277 11:95701020-95701042 AGAGTTCTTCTCTTGTCATGTGG + Intergenic
1092016500 12:5163286-5163308 AGGGCTCTGGTAATGGCATGAGG + Intergenic
1095147207 12:38745189-38745211 AGAGTTCTGCTTTGGCCATGTGG - Intronic
1096688549 12:53305375-53305397 AGACAACTGCTGATGTCATGAGG + Intronic
1097542903 12:60962604-60962626 ATAGGTATACTTATGTCATGGGG - Intergenic
1098853948 12:75631061-75631083 AGAGCTCTTCATATTTTATGGGG - Intergenic
1099754488 12:86826299-86826321 AGGGCTTAGTTTATGTCATGAGG + Intronic
1100804095 12:98262823-98262845 AGAGCTCTGCGAATGTTAGGTGG - Intergenic
1100942807 12:99742195-99742217 ATAGCTAAACTTATGTCATGGGG - Intronic
1102571455 12:113829460-113829482 CCTGCTCTGCTTATCTCATGGGG + Intronic
1103224856 12:119278065-119278087 CAAGCTCTGCTTCTGTCCTGTGG - Intergenic
1107659101 13:42620987-42621009 ACAGCCCAGCTTTTGTCATGTGG + Intergenic
1108301837 13:49085373-49085395 AGGGCTTTGCTTATGTCTTATGG - Intronic
1109560175 13:64037289-64037311 ACAACTCTGCTTTTGTCATATGG + Intergenic
1110499703 13:76212944-76212966 ACAGCTCTTCTTCTGTCATCAGG - Intergenic
1111558067 13:89907279-89907301 AAAGGTTTACTTATGTCATGGGG - Intergenic
1111833979 13:93364300-93364322 TCAGCTCTGCTTATGACACGTGG - Intronic
1112133351 13:96548395-96548417 AGAGCTCTGCTTACGTAAACTGG + Intronic
1121551535 14:94806431-94806453 ATTGCTCTGCTTATGTCTTGGGG - Intergenic
1122416887 14:101554308-101554330 AGAGCTGGGCTTCTGTGATGGGG + Intergenic
1125598907 15:40904931-40904953 GGTGCTCTGCTGATGTCACGGGG - Intergenic
1125786555 15:42323444-42323466 AAAGCCCTGCTTAAGTCTTGAGG - Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1132107463 15:99073666-99073688 ACAGCTCTACTTATTTCCTGAGG - Intergenic
1136990592 16:35149115-35149137 AGACCTCTGCTCCTTTCATGAGG - Intergenic
1137022489 16:35442431-35442453 TGTGCTGTGGTTATGTCATGTGG + Intergenic
1137886721 16:52112241-52112263 ACTGCCATGCTTATGTCATGAGG + Intergenic
1138646832 16:58431725-58431747 AGAGCTCTGATTAATTCATATGG + Intergenic
1141347790 16:83263433-83263455 AGATCTCTGCATATCTCAAGAGG - Intronic
1141438276 16:84013244-84013266 AGACCTCTGCCTAAGTCATTAGG - Intronic
1144095255 17:11894561-11894583 AGAGCCCTGCTGACTTCATGGGG - Intronic
1144658228 17:17051670-17051692 AGAGCTCTGGGTAGGGCATGGGG - Intronic
1147360915 17:39929000-39929022 ATAGCTCTGCCTATGTCCTGTGG + Intergenic
1150054935 17:62005956-62005978 AGTGCTCTGGTTGTGTCAGGAGG - Intronic
1152504775 17:80741581-80741603 AGAGCTCTGCTCAGGCAATGTGG + Intronic
1153943341 18:9995765-9995787 AAGGGTCTGCTGATGTCATGTGG + Intergenic
1155802809 18:30130825-30130847 AGAGCTTTCCTTATGTCACTCGG + Intergenic
1157038515 18:44008023-44008045 AGATCTCTGATAGTGTCATGGGG - Intergenic
1157395520 18:47337719-47337741 GAAGCTCTGCTTATGTCACTGGG + Intergenic
1159567475 18:70068813-70068835 AGATCTCAGGATATGTCATGTGG - Intronic
1160562434 18:79766994-79767016 AGAGCTCTGCTCATCGCAGGAGG + Intergenic
1163580200 19:18134479-18134501 AGAGCTCTGCCCATCTCAGGCGG + Intronic
1164528098 19:29026579-29026601 AAAGCTCTGACTATGTCCTGTGG - Intergenic
1166627509 19:44372405-44372427 AGACCTCTGCTTATGCTATCTGG + Intronic
1167092268 19:47352798-47352820 AGATCACTGCAGATGTCATGAGG + Exonic
925585023 2:5456771-5456793 ATTGCCCTGCTTATGTCCTGAGG + Intergenic
928009866 2:27597142-27597164 AGAGGTTTGCTTATGACATCAGG - Intronic
933083178 2:78020123-78020145 ATAGCTCTGCATATCTAATGAGG + Intergenic
933856847 2:86422572-86422594 AGATCTCTACTTTTGTCATCAGG - Intergenic
934078028 2:88444209-88444231 AGAGCTCTCCTTGAGGCATGAGG + Intergenic
934744581 2:96750787-96750809 AGAGGTCTGATTGTGGCATGAGG - Intergenic
937538470 2:122920444-122920466 AGAGATCTAGTTATGACATGAGG - Intergenic
938545999 2:132332159-132332181 AGACCTCTGCTTATGCTATCTGG - Intergenic
940418220 2:153447390-153447412 GGAGCACTGATTATTTCATGTGG + Intergenic
940614721 2:156035908-156035930 AGAGGTGAGCTCATGTCATGGGG - Intergenic
942609711 2:177730628-177730650 AGAGCTCTTCTTTTGTCGTCTGG + Intronic
943260842 2:185661417-185661439 AGTGTTCTGTTTATGTTATGTGG + Intergenic
943314777 2:186373667-186373689 AGAAATCTGTTTATTTCATGAGG - Intergenic
943338525 2:186648197-186648219 ATATCTCTGATTATGTCATTAGG + Intronic
944310970 2:198233481-198233503 AGAGATCTGCTTGTGAGATGGGG + Intronic
944859608 2:203802604-203802626 ATACCTCTGCTTCTATCATGTGG - Intergenic
945910527 2:215643839-215643861 AAAGCTCTGATTTTTTCATGTGG + Intergenic
945933599 2:215881019-215881041 ACAGCCCTGCTTCTGTTATGTGG - Intergenic
948829352 2:240590503-240590525 AGAGGTCTGTTAATTTCATGTGG + Intronic
1169156952 20:3339604-3339626 AGACCTCTGCTAAGGTAATGGGG + Intronic
1170071815 20:12377500-12377522 AGAGCTCTGCTAATGAGATGAGG + Intergenic
1171093254 20:22306201-22306223 AGAGCTCTGGAAATGGCATGAGG - Intergenic
1171874857 20:30564892-30564914 AGACCTCTGCTTATGCTATCTGG - Intergenic
1173228757 20:41177905-41177927 GGAGTCCAGCTTATGTCATGGGG - Intronic
1175817168 20:61889262-61889284 AGACCTCTCCTTATGTCAGGTGG - Intronic
1176846484 21:13880674-13880696 TGAGATCTGCTTGTGTAATGGGG - Intergenic
1177379036 21:20314360-20314382 AGAGCTCTTCTTAGGTCATAGGG - Intergenic
1178614477 21:34119211-34119233 TGGGCTTTGCTTATGTCATTAGG + Intronic
1181793684 22:25287611-25287633 AAAGCTCTGCTTTAGCCATGTGG + Intergenic
1181833681 22:25584155-25584177 AAAGCTCTGCTTTAGCCATGTGG + Intronic
1183325136 22:37187375-37187397 AGACCTCAGCTTTTCTCATGAGG - Intronic
1183770181 22:39917919-39917941 AGAACTCTTCTTATGTAATGTGG + Intronic
1183865217 22:40698979-40699001 AGTTCTCTGCTTAGGTCCTGTGG - Intergenic
1185416662 22:50714366-50714388 CGAGAGCTGCTTATGTCCTGGGG + Intergenic
949330660 3:2918166-2918188 AGAGCTATGTTTATGCAATGCGG - Intronic
951316952 3:21198968-21198990 AGATATCTGATTATGTCATTAGG + Intergenic
953210063 3:40867940-40867962 AAAGCTGTGGTCATGTCATGAGG + Intergenic
955344632 3:58152051-58152073 TGTGCTCTGCTTATTTCTTGAGG + Intronic
956475180 3:69611833-69611855 AGAGCTCTCCTTCTGCCATCTGG - Intergenic
956737753 3:72251388-72251410 AGTGCTCTGCTTATGGAATGAGG - Intergenic
960575909 3:119229198-119229220 GGTGCTCTGCTGATGCCATGAGG + Intronic
960941970 3:122940809-122940831 AGAGCTCTGCTAAGGACTTGGGG - Intronic
961404608 3:126669130-126669152 AGATCTGAGCTGATGTCATGAGG + Intergenic
962914950 3:139892632-139892654 AGAGCTTTAATTATCTCATGAGG + Intergenic
963839365 3:150090044-150090066 AAAGCTGTGCTTATGTATTGGGG - Intergenic
965493432 3:169367875-169367897 TGAGATCTCCTTAGGTCATGTGG + Intronic
966480271 3:180400374-180400396 ATAGGTAAGCTTATGTCATGGGG + Intergenic
968427943 4:535519-535541 AGAGCTTTGCGTGTGTCCTGTGG + Intronic
970451386 4:16169622-16169644 AGAGCTGTGTGTAGGTCATGTGG - Intronic
971365185 4:25971470-25971492 GGAGCTCTGCCTGTGCCATGGGG - Intergenic
975225579 4:71867258-71867280 AGAGCTATGATTATGTGGTGTGG - Intergenic
975830948 4:78367734-78367756 AGAGTTCTGCTTATTTCACTTGG + Intronic
980441771 4:132857306-132857328 AGAGCTTGGCATATGTCATCTGG + Intergenic
980475975 4:133317085-133317107 AGATCTATGCTTTTGTCCTGTGG + Intergenic
982993976 4:162317424-162317446 AGAGTTCTGCTGGTGTCTTGAGG - Intergenic
985004304 4:185518232-185518254 AGAACTCTGCTGATGTTAAGAGG + Intronic
989039193 5:37209235-37209257 AGAGCCCTGCTTCTGTCCTGAGG - Intronic
990363392 5:55044267-55044289 AGAGCTCTGCTTCTTGCATTTGG - Intergenic
990468258 5:56089383-56089405 AGATCTCTGCTTCAGTCCTGGGG + Intergenic
991128898 5:63098536-63098558 AGATCTCTGCTTCTGACCTGGGG - Intergenic
992974034 5:82093866-82093888 AGAGCTTTGCCTCTGTAATGGGG - Intronic
993415959 5:87631332-87631354 AGTTCTCTGCTTTTGCCATGAGG - Intergenic
994913288 5:105941772-105941794 AGATCTTTGATTATCTCATGTGG + Intergenic
999716006 5:154360488-154360510 AGAGCTCTGCTTATGTCATGTGG - Intronic
999890010 5:155967317-155967339 CTACCTCTGCTTATGACATGGGG - Intronic
1000107161 5:158070998-158071020 AGGGCTCAGCTGATGTCATGAGG + Intergenic
1005235191 6:23753421-23753443 ATAGGTAAGCTTATGTCATGTGG - Intergenic
1006283808 6:33078063-33078085 ACAGCTCTGCCTATGGGATGGGG - Intronic
1007856132 6:44860053-44860075 AGAGCTGTGCTTATCTCAGTGGG - Intronic
1008749129 6:54710788-54710810 AGAGCTATTGTTATGACATGGGG - Intergenic
1008809017 6:55469734-55469756 AGGGGGCTTCTTATGTCATGGGG + Intronic
1010175977 6:73028409-73028431 AGAGCTCTCCTTGTTTCAAGAGG + Intronic
1010958448 6:82118135-82118157 ACAGCTCTGCTGGTATCATGTGG - Intergenic
1012337465 6:98078876-98078898 ATAGCTCATCTCATGTCATGGGG + Intergenic
1016755544 6:147681791-147681813 AGAGTTCTGCCTAAGTGATGGGG - Intronic
1016944252 6:149513971-149513993 AGAGCTATGCTAATTACATGTGG + Intronic
1018308912 6:162488475-162488497 TGAGCTCTGCTGATCTCATGAGG - Intronic
1018835160 6:167477617-167477639 ACAGCTCTGCTGATGTCTTCGGG + Intergenic
1019121115 6:169804647-169804669 AGAGCTCTGTGTATGTGGTGAGG - Intergenic
1020680161 7:11227117-11227139 GGAGCACAGCTTTTGTCATGGGG + Intergenic
1021345893 7:19528203-19528225 ATAGCTAAACTTATGTCATGAGG + Intergenic
1022189340 7:28001965-28001987 TGAGGTCTGCTTCTGACATGTGG + Intronic
1023787076 7:43718389-43718411 AGAGCTCCACTGATGTCAAGTGG - Intronic
1024889690 7:54185750-54185772 AGGGCTCTGCTTTCGTGATGAGG + Intergenic
1031319880 7:120311620-120311642 ATAGGTATACTTATGTCATGGGG + Intronic
1034297562 7:149987848-149987870 ATAGATAAGCTTATGTCATGGGG - Intergenic
1041250863 8:55933901-55933923 ACGGCTGTGCTTATGTCTTGTGG + Intronic
1042701873 8:71624482-71624504 AGAGTTCTGCTGATGCCAAGTGG - Intergenic
1046662605 8:116964679-116964701 AGAGCTCTGGGTATCTTATGTGG - Intronic
1048801648 8:138199462-138199484 AGACCTCAGCTGATGCCATGGGG + Intronic
1049064709 8:140304047-140304069 TGAGCTCTTCTTATGTCATAGGG + Intronic
1049465348 8:142748966-142748988 TGAGCTCTGATTTTGTCAAGAGG - Intergenic
1050459955 9:5869305-5869327 ACACCTCTGATTATGTCCTGAGG + Intergenic
1052698496 9:31909170-31909192 AGATCTGTCCCTATGTCATGGGG - Intergenic
1053345304 9:37373757-37373779 AGAGCCCTGCTTCTGTGGTGGGG - Intergenic
1059686245 9:116639538-116639560 GGAGCTCTTCTTAGGTCATTAGG - Intronic
1059933134 9:119281259-119281281 AGAGCTCTTCATTTGTCATTTGG + Intronic
1060064462 9:120491165-120491187 AGAGCTTTAATTATGTCATTTGG - Intronic
1185816020 X:3156774-3156796 GGAGCTTTGCTTATGTCAGTTGG - Intergenic
1189912089 X:45820413-45820435 AGAGTTCTACTTAACTCATGAGG + Intergenic
1196396011 X:115262344-115262366 AGAGCTCTGTTTAAGAGATGAGG + Intergenic
1199574541 X:149300791-149300813 ATAGCTCTGCTTACCTCACGGGG + Intergenic
1200975259 Y:9205630-9205652 ACATATCTGGTTATGTCATGGGG - Intergenic
1201265428 Y:12201827-12201849 GGAGCTTTGCTTATGTCAGTTGG + Intergenic
1201980218 Y:19899186-19899208 AGAGCCCGGGTTATGTCATGAGG - Intergenic
1202135893 Y:21660892-21660914 ACATATCTGGTTATGTCATGGGG + Intergenic