ID: 999717319

View in Genome Browser
Species Human (GRCh38)
Location 5:154371742-154371764
Sequence CAATGCAAGGAGAATGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 318}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999717319_999717327 -4 Left 999717319 5:154371742-154371764 CCTGCCCCATTCTCCTTGCATTG 0: 1
1: 0
2: 2
3: 16
4: 318
Right 999717327 5:154371761-154371783 ATTGGCTCTGAGGAGTCCTTGGG 0: 1
1: 1
2: 0
3: 16
4: 186
999717319_999717326 -5 Left 999717319 5:154371742-154371764 CCTGCCCCATTCTCCTTGCATTG 0: 1
1: 0
2: 2
3: 16
4: 318
Right 999717326 5:154371760-154371782 CATTGGCTCTGAGGAGTCCTTGG 0: 1
1: 0
2: 1
3: 20
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999717319 Original CRISPR CAATGCAAGGAGAATGGGGC AGG (reversed) Intronic
900326943 1:2112986-2113008 AAATGTAAAGAAAATGGGGCCGG - Intronic
901772797 1:11539116-11539138 CCATGCAGGGGAAATGGGGCAGG + Intergenic
901958584 1:12807004-12807026 AAATGCTGGGCGAATGGGGCAGG + Intergenic
902894937 1:19473010-19473032 AAATGCAGGAAGAATGGGCCGGG - Intronic
903021358 1:20397536-20397558 GAAGACAAGGAGAAGGGGGCTGG + Intergenic
904449620 1:30602399-30602421 GCATGGAAGGAGAATGGGGGAGG - Intergenic
904597174 1:31654166-31654188 CAGGGCAAGGAGTATGGGGGTGG + Intronic
906179797 1:43808373-43808395 CAATGGAAAGATAATTGGGCAGG + Intronic
907196938 1:52694700-52694722 CAATGAAATGGGAGTGGGGCAGG + Intronic
908260226 1:62334570-62334592 CAGTGCAAGGAGGATGGTGTGGG + Intergenic
908372318 1:63495576-63495598 CAAAGAAAGTAGGATGGGGCAGG + Intronic
908532822 1:65049794-65049816 CAATGCTAAGAGAAGGAGGCAGG - Intergenic
910203680 1:84725882-84725904 CAATTCAATGAGATTTGGGCGGG - Intergenic
912776736 1:112510263-112510285 CCATCCAAGGAGTAGGGGGCAGG - Intronic
914869196 1:151459039-151459061 CAATGAGAGGGGGATGGGGCCGG - Intronic
915583221 1:156828687-156828709 CAATGGAAGGAGAGTGGTGGGGG + Intronic
916357759 1:163932191-163932213 CAATGAAAGGACAATGTAGCAGG + Intergenic
916617231 1:166454459-166454481 CAATTCAATGAGATTGGGGCAGG + Intergenic
916810354 1:168300261-168300283 CGAAGGAAGGAGAATGGGGAAGG + Intronic
918301024 1:183203992-183204014 CATTTAAAGGACAATGGGGCAGG + Intronic
918615023 1:186534290-186534312 AAATGAAATGAGAATGGGGGTGG + Intergenic
919922618 1:202175530-202175552 AAAGGCAAGGAGCATGGAGCTGG - Intergenic
919929886 1:202214344-202214366 CAATGGAAGGGGATTAGGGCCGG - Intronic
920086213 1:203419308-203419330 CAAGGCAGGGAGAAGGGGGAGGG + Intergenic
920100789 1:203515795-203515817 GAATGCAAGCAGAGTGGGGTGGG + Intergenic
920497458 1:206465426-206465448 GACTGCAGGGAGAATGGGGATGG + Intergenic
921836845 1:219787209-219787231 CCTGGCAGGGAGAATGGGGCTGG - Intronic
921929517 1:220743607-220743629 CACTGCCAGGAGACTGGGGAGGG + Intergenic
923760396 1:236837378-236837400 TGAAGCATGGAGAATGGGGCAGG - Intronic
1065263776 10:23954266-23954288 CAATGAAAGGGAAAGGGGGCCGG + Intronic
1065349775 10:24785091-24785113 CTATGCAAGTAGAATGGAGGAGG + Intergenic
1066017735 10:31264827-31264849 TCATGCAAGGAGAATCAGGCAGG + Intergenic
1066746459 10:38606486-38606508 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1067278322 10:44853405-44853427 CAAAGCTGGGAAAATGGGGCTGG - Intergenic
1067455333 10:46415067-46415089 CAATGGAGGGAGAAAGTGGCTGG + Intergenic
1067472126 10:46545113-46545135 CAATGCATGGAGAAAAGGGTTGG + Intergenic
1067631871 10:47969568-47969590 CAATGGAGGGAGAAAGTGGCTGG - Intergenic
1070870294 10:79745369-79745391 CACAGCAAGGAGAATGTGGCAGG - Intergenic
1071178539 10:82956009-82956031 AAATGGAAGCAGAATTGGGCTGG - Intronic
1071637213 10:87267589-87267611 CACAGCAAGGAGAATGTGGCAGG - Intergenic
1071658033 10:87470365-87470387 CTCAGCAAGGAGAATGTGGCAGG + Intergenic
1072947195 10:99820696-99820718 CCAGGCCAGGAGAGTGGGGCAGG + Intronic
1073935617 10:108627797-108627819 TAATGCTAGGAGAATGGGATTGG - Intergenic
1074350506 10:112732424-112732446 CACTGCACAGAGAATGGGGCAGG - Intronic
1075923547 10:126233057-126233079 CAATTCAAGGGGCCTGGGGCTGG + Intronic
1076366616 10:129925261-129925283 GGGTGCAAGGAGAATGGGGTGGG + Intronic
1076565677 10:131397481-131397503 GAACGCAAGGAGCATGGGGAAGG + Intergenic
1077880119 11:6342553-6342575 CAAGGAAAGCAGAATGGAGCAGG - Intergenic
1080396271 11:31893159-31893181 AAAGGCAAAGAAAATGGGGCAGG - Intronic
1080430224 11:32191024-32191046 TAAAGCACGGAGAATGGGGTGGG + Intergenic
1081073837 11:38643215-38643237 CACTGCCAGGAGATTGGGGAGGG + Intergenic
1083973335 11:66096994-66097016 CAAAGAAATGAAAATGGGGCTGG - Intronic
1085304129 11:75475643-75475665 GACTGCAGGGAGAAAGGGGCGGG + Intronic
1087890051 11:103527672-103527694 AAATGCTAGGAGAAGGGTGCTGG - Intergenic
1090480277 11:127061760-127061782 CAAAGAAAGGAGAAGGGGGAAGG - Intergenic
1090775148 11:129957995-129958017 CAATGACAGGAGAATGGGGATGG + Intronic
1091295120 11:134468386-134468408 GAATGCGAGGAGAAAGGAGCAGG - Intergenic
1091344879 11:134845940-134845962 CAGTGCTGGGAGATTGGGGCAGG - Intergenic
1091346315 11:134856688-134856710 CAGTGCACGTAGAATGTGGCTGG + Intergenic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1092860063 12:12712609-12712631 CAAAGCAAGGAGAAAGAGGAAGG - Intergenic
1093558480 12:20508126-20508148 CAGTGCAATGAGAATGTGCCTGG - Intronic
1095958954 12:47821649-47821671 CAACAGAAGGAGAAAGGGGCTGG - Intronic
1096231974 12:49901857-49901879 TGATGCAAGGAGAATGGAGATGG + Intronic
1100263884 12:92957795-92957817 CAATGGAGGGAGAAGGGGGAGGG - Intergenic
1102587484 12:113933335-113933357 CAATGCAAAGAGGGTGGGGGTGG + Intronic
1102794031 12:115672986-115673008 CAAAGCAAGGGGAAAAGGGCTGG + Intergenic
1102904357 12:116662758-116662780 CAAGGCAAGGAGAAAGGAGAGGG - Intergenic
1104162391 12:126192458-126192480 CTAGGCAAGGAGCATGGGACAGG + Intergenic
1105359382 13:19692874-19692896 CAATGTAGGGAGGCTGGGGCTGG + Intronic
1106431562 13:29685510-29685532 TAGTGCAAGGAGAATGTGTCCGG + Intergenic
1106568157 13:30904951-30904973 CCCTGCAAAGAGAATGGGTCTGG - Intergenic
1110490120 13:76093607-76093629 CAATACCAAGAGAATGAGGCTGG + Intergenic
1111964916 13:94851240-94851262 CAATTCAAGGAGATTTGGGTGGG - Intergenic
1113222427 13:108120419-108120441 AAATGCAAGAAGAAAGTGGCAGG - Intergenic
1113564319 13:111309644-111309666 CAAGGCAAGGAAAAGGGGGAGGG + Intergenic
1116090132 14:40294092-40294114 CAATGATATGAGAACGGGGCAGG - Intergenic
1116290039 14:43022578-43022600 GAATGAAAGAAGAATGGGGAAGG - Intergenic
1118318171 14:64738048-64738070 GAAGGCAACGAGAAGGGGGCTGG + Intronic
1119213136 14:72847804-72847826 TAAAGAAAGGAGAATGAGGCTGG - Intronic
1119558828 14:75573810-75573832 TTAAACAAGGAGAATGGGGCCGG - Intergenic
1119617731 14:76109960-76109982 CACTGGAAGGAGGTTGGGGCTGG - Intergenic
1119663306 14:76466292-76466314 AAACACAAGGAGAATGTGGCTGG - Intronic
1121128127 14:91421197-91421219 CAAGGGTAGCAGAATGGGGCAGG - Intergenic
1122298006 14:100716359-100716381 CAATGCAACGGCAATGGGACTGG - Intergenic
1125021075 15:34987741-34987763 CAAGGCCAAGAGAATGGGCCCGG - Intronic
1125409901 15:39395254-39395276 CAATGGAAGGAGAAAGAGGAAGG + Intergenic
1128215039 15:65928677-65928699 AGATGCAGGGAGACTGGGGCTGG + Intronic
1128694837 15:69753722-69753744 GAATGCAAGGAAAATGTGGGGGG - Intergenic
1128837568 15:70823183-70823205 CCATGCAAGGAGAAAAGAGCTGG - Intergenic
1129572866 15:76708445-76708467 AAATGCAGGGAGGGTGGGGCAGG + Intronic
1130929221 15:88410542-88410564 AAATACAAGGAGCATGGGGTAGG - Intergenic
1130982204 15:88820538-88820560 CAAGGCAGGGAGAAAGGAGCAGG - Intronic
1131311620 15:91295878-91295900 CACTGCAAGTGGAATGAGGCAGG - Exonic
1131364597 15:91827596-91827618 CAATGAAAGGAGGAAGGGGAGGG + Intergenic
1133141994 16:3751948-3751970 CAATGAAAGGAACAGGGGGCAGG + Intronic
1134455556 16:14392858-14392880 TACTGTAAGAAGAATGGGGCCGG + Intergenic
1136736602 16:32473156-32473178 CAGGGGAAGGAAAATGGGGCAGG - Intergenic
1138550414 16:57744657-57744679 CAATGCCAGGCTAATGGGGGTGG - Intronic
1141977125 16:87524377-87524399 AGATGGAAGGAGAGTGGGGCAGG + Intergenic
1203016466 16_KI270728v1_random:356421-356443 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1203034801 16_KI270728v1_random:629579-629601 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1143097637 17:4486875-4486897 GAAAGGAAGGAGAAAGGGGCCGG + Intronic
1144036563 17:11371257-11371279 CTATACAATGAGAAGGGGGCTGG - Intronic
1144424208 17:15126025-15126047 CTGTGCAAGAAGCATGGGGCCGG - Intergenic
1145901237 17:28491660-28491682 CACTGGGAGGTGAATGGGGCTGG + Intronic
1146299365 17:31676259-31676281 GAATGAAAGAAAAATGGGGCTGG + Intergenic
1147112958 17:38277451-38277473 CAGAGGAAGGAGAATGGGGTGGG - Intergenic
1147634880 17:41957717-41957739 GAATGCAAGGTGATGGGGGCTGG - Intronic
1147914566 17:43878776-43878798 CATAGGAAGGAGGATGGGGCTGG + Intronic
1148416663 17:47511774-47511796 CAGAGGAAGGAGAATGGGGTGGG + Intergenic
1148633732 17:49131805-49131827 AAATGCATGCAAAATGGGGCCGG - Intergenic
1148717839 17:49728490-49728512 GAATGCAGAGGGAATGGGGCTGG + Intronic
1151479729 17:74362836-74362858 CAATGTAAGGAAACTGAGGCAGG + Intergenic
1152706289 17:81845270-81845292 CAATGCCAGGAGATTGGCTCTGG - Intronic
1154324165 18:13377881-13377903 CAATTCAAGGTGAGTGGGGGTGG - Intronic
1155219486 18:23671416-23671438 CCCAGCAAGTAGAATGGGGCTGG + Intergenic
1156573629 18:38286685-38286707 CAAAGCAAGGAGAATAGGTAAGG - Intergenic
1156844770 18:41652657-41652679 CAGTGAAAGAAGAATGGGGCAGG + Intergenic
1157623398 18:49028990-49029012 CAAAGAATGGAGAATGTGGCTGG - Intergenic
1158312216 18:56171032-56171054 CAATGCAAGGAGACTGTAGGAGG - Intergenic
1158633332 18:59135017-59135039 GATTGCAAGGAGCATAGGGCAGG + Intergenic
1160301602 18:77686703-77686725 CAATGAGTGGAGAATGAGGCTGG - Intergenic
1160348892 18:78157934-78157956 AAATGGCAGCAGAATGGGGCCGG - Intergenic
1160948980 19:1656760-1656782 GAAGGCAGGAAGAATGGGGCCGG - Intergenic
1161331556 19:3690867-3690889 CTGTGCAAGGAAAATGGGCCGGG + Intronic
1161912864 19:7207626-7207648 TAAAGAAAGGAGAATGGGCCGGG + Intronic
1162082980 19:8230123-8230145 GAAAGGAAAGAGAATGGGGCAGG - Intronic
1162604705 19:11697676-11697698 CAAAGGGAGGAGAATGGAGCTGG - Intergenic
1163703075 19:18796240-18796262 GAGTAAAAGGAGAATGGGGCTGG - Intergenic
1164157083 19:22603451-22603473 CAAAGCCAGGAGAAGGGGGGTGG + Intergenic
1167529098 19:50003835-50003857 CAGTGCAGGGAGAGCGGGGCTGG - Intronic
925143191 2:1564016-1564038 AAAAGCCGGGAGAATGGGGCAGG + Intergenic
925172024 2:1755750-1755772 AAAAGGAAGGAGAAAGGGGCTGG - Intergenic
925673647 2:6337798-6337820 CAGTGCAAGGAAATTGAGGCGGG - Intergenic
926235505 2:11040223-11040245 CAAGGAAAGAAGGATGGGGCAGG - Intergenic
928940954 2:36726876-36726898 AAAGGCAAGGAGAAAGGGGGTGG + Intronic
929454100 2:42054335-42054357 CCATCGAAGGAGAATGGGCCAGG + Intronic
929655129 2:43723429-43723451 CAAGGCAAAGAGACTTGGGCTGG + Intronic
929818054 2:45251613-45251635 CAATGAAAGGAGAAGGAGGTTGG - Intergenic
929895925 2:45960817-45960839 AACTGCAAGGAGAGTGAGGCAGG - Intronic
930479629 2:51930531-51930553 CAATGCAAGGTGATGGGGGGAGG + Intergenic
930578003 2:53175862-53175884 CAATTCAAGGAGAGTTGGACTGG - Intergenic
931849558 2:66238439-66238461 CAATCCAAGGTGAGTGGGGTAGG + Intergenic
932412265 2:71554520-71554542 CAGTGCAAGGAGATGGGGGGTGG + Intronic
932498214 2:72158172-72158194 CAACTCATGGAGAATGGGGAGGG - Intergenic
933352164 2:81167965-81167987 CACTGCAAGCAAAATGTGGCTGG + Intergenic
933902910 2:86862038-86862060 CAATGCTAGGAGGATGAGGGCGG - Intergenic
934187756 2:89762273-89762295 CAGGGGAAGGAAAATGGGGCAGG - Intergenic
934308861 2:91845675-91845697 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
934557566 2:95295518-95295540 CAGTGAAAGGAGGATGGGGCTGG + Intergenic
935777635 2:106487231-106487253 CAATGCTAGGAGGATGAGGGCGG + Intergenic
936946899 2:117939289-117939311 CAATGAAAGGAGAATGTTGAAGG + Intronic
938198447 2:129353209-129353231 CAATTCTAGGAAAATGGGGCAGG - Intergenic
938231563 2:129665690-129665712 CAGTGCTAGGACAATGGAGCTGG + Intergenic
938623166 2:133078622-133078644 CAAGACAAGGAGAATGAGACAGG + Intronic
939575879 2:143893899-143893921 CAATGCAAAGAGAAAGGGGCCGG - Intergenic
940280705 2:151986781-151986803 CAATGCTAGGAGAATCAGACTGG - Intronic
940452502 2:153857455-153857477 AAATCCAGGGAAAATGGGGCAGG + Intergenic
941391202 2:164917161-164917183 CAATGCATGAAGAATGGAACAGG + Intronic
944402564 2:199345080-199345102 AAATGCCAGGAGATGGGGGCAGG - Intronic
944662369 2:201931916-201931938 CAATGCAAGGAGAAAGCATCAGG - Intergenic
945259640 2:207831729-207831751 CACTGGAAGGAGGAGGGGGCTGG - Intronic
946656823 2:221957644-221957666 CAAAACAAGGAGGATGGGTCAGG + Intergenic
948028839 2:234800144-234800166 CAGAGCAAGGAGGATGGAGCTGG + Intergenic
948394601 2:237635404-237635426 CAATGAAAGGAGTGTGGGGATGG + Intronic
1169523726 20:6400734-6400756 GAAAGCAAGGAGCATGAGGCAGG - Intergenic
1169854131 20:10085015-10085037 CAAAGCAAGGAAAAAGGGCCAGG - Intergenic
1170295451 20:14819804-14819826 CATTGAAAGGACAATGTGGCTGG + Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170448439 20:16455823-16455845 CAATGCAGAGAGAATGTGCCTGG + Intronic
1172116411 20:32575955-32575977 CAGTGCAAGGGGCCTGGGGCAGG + Intronic
1172914692 20:38434870-38434892 CAATGCCAGGAGTCGGGGGCGGG + Intergenic
1172997863 20:39083993-39084015 CCAAGCAAGGACAGTGGGGCTGG + Intergenic
1173017244 20:39236892-39236914 CAAGGCATGGAGAGTGGAGCTGG - Intergenic
1175874500 20:62222953-62222975 CAATGCAGGGTGCATGTGGCTGG + Intergenic
1176336121 21:5601640-5601662 CACTGAAAGAAGAGTGGGGCGGG + Intergenic
1176391636 21:6219308-6219330 CACTGAAAGAAGAGTGGGGCGGG - Intergenic
1176469783 21:7096866-7096888 CACTGAAAGAAGAGTGGGGCGGG + Intergenic
1176493344 21:7478644-7478666 CACTGAAAGAAGAGTGGGGCGGG + Intergenic
1176507298 21:7659739-7659761 CACTGAAAGAAGAGTGGGGCGGG - Intergenic
1176922808 21:14708772-14708794 CAAGGCAAGGAGAAGGTGACTGG - Intergenic
1178184773 21:30206959-30206981 CTCTCCAAGGAGTATGGGGCTGG + Intergenic
1178789774 21:35689213-35689235 CACTGTCAGGAGATTGGGGCTGG + Intronic
1179431941 21:41327491-41327513 GAATGCAAGGTGAATAAGGCAGG - Intronic
1179723317 21:43328314-43328336 CAATCCCTGGAGAAGGGGGCTGG + Intergenic
1180535944 22:16392763-16392785 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1180938287 22:19640286-19640308 CAAGGGGAGGAGAATGGGGATGG - Intergenic
1182403992 22:30108485-30108507 CCAGGCAAGGTGTATGGGGCAGG - Intronic
1182558830 22:31143194-31143216 CTATGCCAGGAGAATGGGGGGGG + Intergenic
1183364015 22:37397740-37397762 CAATGTAAGAAGAAGTGGGCAGG - Intronic
1183731735 22:39622282-39622304 GGAGGCAGGGAGAATGGGGCTGG + Intronic
1184533203 22:45070118-45070140 CAATGTGGGGAGGATGGGGCGGG + Intergenic
950113703 3:10436866-10436888 AGATGCAAGGGGAAAGGGGCTGG - Intronic
952455556 3:33468369-33468391 CCTACCAAGGAGAATGGGGCAGG - Intergenic
952887239 3:38019182-38019204 CAATGGCAGGAGAATGGGCGAGG + Intronic
953013889 3:39053850-39053872 CAGTGCACGTAGAATGAGGCAGG + Intronic
955012304 3:55030209-55030231 CAATACAGGGAGGATGTGGCTGG - Intronic
956160795 3:66350220-66350242 CACTGCAGGGAGTAAGGGGCTGG + Intronic
957016980 3:75077911-75077933 CAATGCAACCAGAATGAGACTGG - Intergenic
958923864 3:100136548-100136570 CTAGGAAAGGAAAATGGGGCAGG - Intronic
959279574 3:104321645-104321667 CAATGCAAAAAGAATGAGACTGG + Intergenic
959283775 3:104380707-104380729 CTATGCAAGAAGCATGGTGCTGG - Intergenic
960247156 3:115412476-115412498 CAAAGGAAGGACAATGGGGCTGG - Intergenic
961779443 3:129313179-129313201 CCCTGCAAGGAGTATGGGACAGG + Intergenic
962338434 3:134559913-134559935 CAATGGAAGGAGCAAGGGACCGG - Intronic
962865420 3:139444545-139444567 CAATGCCTGGTGACTGGGGCTGG + Intergenic
963756820 3:149243091-149243113 CAATCCAAGGAGGATGACGCGGG - Intergenic
964017731 3:151967712-151967734 CAATCTAAGGAGAATGGAACTGG + Intergenic
964415035 3:156438314-156438336 CAATGCAAGAAGCAAGGGGCAGG + Intronic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
966185851 3:177226397-177226419 TAATCCAAGAAGAATGGGACTGG + Intergenic
966462184 3:180189059-180189081 CAATAATAGGAGAATGGGGAAGG - Intergenic
966723060 3:183083909-183083931 CAATGAATAGGGAATGGGGCTGG + Intronic
967718576 3:192790727-192790749 CAATATAAGGAGACTGGGTCTGG + Intergenic
970706067 4:18804371-18804393 CAAGGCCAGGAGATTGGGTCAGG + Intergenic
971699915 4:29958715-29958737 CAATGTAAGGAAAATGGGTGTGG - Intergenic
972351998 4:38244559-38244581 CAAGGGAAGGAGGAGGGGGCCGG - Intergenic
973570506 4:52234185-52234207 GAAGGGAAGGAGAAAGGGGCAGG - Intergenic
974916702 4:68186641-68186663 AAAGGCAAGGAGATGGGGGCAGG + Intergenic
976621457 4:87132382-87132404 CAATGCATGGAGAAGGTGCCTGG - Exonic
976946376 4:90773955-90773977 CAATGAAATGAGAATTGTGCTGG + Intronic
977726296 4:100300670-100300692 CAAATCAAGGAGATTGGGGAAGG - Intergenic
978315605 4:107433117-107433139 CAATGCACTAAGAATGGGCCAGG - Intergenic
978400838 4:108328988-108329010 CAATGCAAGGTGAATTGAGAAGG + Intergenic
978964898 4:114728702-114728724 CAATGCTAGGAGCGTGGGGAAGG - Intergenic
980103425 4:128564473-128564495 CTTTGCAGGGAGAATGGGGAGGG + Intergenic
980530446 4:134046185-134046207 CTCAGCAAGGGGAATGGGGCAGG + Intergenic
980729485 4:136808784-136808806 CAATGTAAGGAGAATAGAGGAGG + Intergenic
981398716 4:144286127-144286149 CAATCCATGGACAATGGGTCTGG + Intergenic
982297152 4:153840957-153840979 CAAGGCAAGAAAAATGTGGCTGG - Intergenic
983872739 4:172841023-172841045 CTATGGAAGGAGAATGGTGGAGG - Intronic
985219032 4:187683042-187683064 TCATGCAAGGAGAATGAGGAGGG + Intergenic
985544681 5:503559-503581 GAAGGAAGGGAGAATGGGGCGGG + Intronic
985730056 5:1542602-1542624 CTACTCAAGGAGAATGAGGCAGG + Intergenic
986739629 5:10694732-10694754 CCATACAAAGTGAATGGGGCTGG + Intronic
990253539 5:53941993-53942015 CCATGTAAAGAGTATGGGGCGGG + Intronic
992056795 5:72998141-72998163 GAATGTAAGGGGAATGGGACAGG + Intronic
993456055 5:88128944-88128966 CAATGTAAGGAAAATGGCACAGG + Intergenic
993870862 5:93252559-93252581 CAATGCAAGAAGCCTGGGGTTGG - Intergenic
994812299 5:104536255-104536277 CAATAGAAGGAGAATGTGCCTGG - Intergenic
995600457 5:113790168-113790190 CCAAGCAAAGAGAATGGGGCTGG + Intergenic
996882595 5:128317069-128317091 CAGTGCAAGGGGCATGTGGCAGG - Intronic
998184414 5:139967675-139967697 CTATGAAAGGAGAACAGGGCCGG + Intronic
999622457 5:153486902-153486924 CAAATCAAGGAGAATGGTGTTGG - Intergenic
999717319 5:154371742-154371764 CAATGCAAGGAGAATGGGGCAGG - Intronic
1001007812 5:168069827-168069849 CAAGTCAAGGAGAATGGTGGTGG + Intronic
1001133092 5:169080440-169080462 CAAGGCAAGGAGTCTGCGGCTGG + Intronic
1003017388 6:2478862-2478884 CAAGGGAAGGAGAATGGGCCAGG + Intergenic
1003504144 6:6725796-6725818 AAATGCAATGAGAAGGGGGATGG - Intergenic
1003846742 6:10181796-10181818 CAGTGCAAGAAAATTGGGGCTGG + Intronic
1004177731 6:13354734-13354756 CAAGGGAAGGAGAAGGGAGCAGG - Intergenic
1004342279 6:14818192-14818214 CAATGCAGGAGGAAAGGGGCAGG + Intergenic
1005758297 6:28945198-28945220 CAATGCAATGAGACTGAGGGGGG - Intergenic
1006444781 6:34074081-34074103 CCCTGCCAGGAGAACGGGGCTGG + Intronic
1007590157 6:43016227-43016249 CAATGCAAAGGGGAAGGGGCTGG - Intronic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1008712674 6:54247662-54247684 CAATGCCAGGAAGATGGGTCTGG + Intronic
1009771292 6:68145612-68145634 CAAAGCCAGTAGACTGGGGCAGG - Intergenic
1009967907 6:70596395-70596417 GAAGGAAAGGAGAATGGGGTAGG - Intergenic
1011621931 6:89251245-89251267 CAATAAAATCAGAATGGGGCTGG + Intergenic
1012627963 6:101427306-101427328 CAGAGCAATGAGAATGGGGATGG - Intronic
1013048339 6:106509742-106509764 GAATGGAAGGAGCATGGGGTGGG + Intergenic
1016383363 6:143507963-143507985 GAATTAAAAGAGAATGGGGCTGG - Intronic
1016798856 6:148147531-148147553 CAATACAAGGAGAAGGGGAAGGG + Intergenic
1018930943 6:168239907-168239929 CAATGCAAGGTGGAGGGTGCGGG - Intergenic
1019127504 6:169850763-169850785 TCATTCAAGGAGTATGGGGCAGG - Intergenic
1019397617 7:830634-830656 CAAAGCAAGGAAGATGGGGATGG - Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019816182 7:3202443-3202465 CAAGACAAGGAGAGTGGGGTGGG - Intergenic
1019832733 7:3349381-3349403 AACTGGAAGGGGAATGGGGCTGG + Intronic
1020384726 7:7587314-7587336 CAAAACAAGGATACTGGGGCAGG - Intronic
1021446333 7:20737369-20737391 CAAAGGATGGAGAATGGAGCCGG - Intronic
1022879791 7:34574574-34574596 TAATTAAAGGAGAATGAGGCAGG - Intergenic
1023154016 7:37229775-37229797 CAATGCAAAGAAAATGAGACTGG + Intronic
1023629871 7:42153537-42153559 AAATGAAGGGAGGATGGGGCGGG + Intronic
1023883305 7:44333895-44333917 CAATGCAATGCCAATGGAGCAGG + Intronic
1024509463 7:50191881-50191903 CATTTCAAGAAGGATGGGGCGGG + Intergenic
1025035066 7:55588805-55588827 CAGAGTCAGGAGAATGGGGCAGG - Intergenic
1025811725 7:64879951-64879973 CTAAGCAAGGAAAATGGTGCAGG - Intronic
1025812197 7:64882420-64882442 CTAAGCAAGGACAATGGTGCAGG - Intronic
1026906557 7:74066097-74066119 CAAGGACAGGAGACTGGGGCTGG + Intronic
1027732863 7:81898113-81898135 CAAAGCAGGGAAAATGGTGCTGG - Intergenic
1030106404 7:105990901-105990923 CAATCAAGGGTGAATGGGGCAGG + Intronic
1030698026 7:112607561-112607583 CAATGTAAGGTCAATGGGGTTGG - Intergenic
1030736809 7:113058717-113058739 CACTGCAAGTAGAGTGGGGAGGG + Intergenic
1031134523 7:117872133-117872155 CAATGGAAGGAGAAACGGGGAGG - Intronic
1031695537 7:124847789-124847811 CAATGCAAGGAGAATGCAAATGG + Intronic
1033426888 7:141252881-141252903 CAGGGCAAGGAGAATGGAGCTGG - Intronic
1034169845 7:149054560-149054582 CAATGCAAACAGAAAGGGTCAGG + Intergenic
1034197662 7:149260862-149260884 CAATGCAAACAGAAAGGGTCAGG - Intergenic
1035726263 8:1825609-1825631 CCATGGAAGGGGAGTGGGGCTGG - Intronic
1037590356 8:20306707-20306729 GAATGCATAGAGAGTGGGGCTGG + Intergenic
1038310545 8:26443118-26443140 CACTGAAAGGAGAAAGGGGGAGG + Intronic
1038642273 8:29338049-29338071 CCATGCAAGGGGAAGGGGACTGG + Intronic
1039434020 8:37547297-37547319 CAAGCCAAGGAGGAGGGGGCTGG - Intergenic
1039661835 8:39476737-39476759 CATTGTAGGGAGAATTGGGCAGG - Intergenic
1040417294 8:47206610-47206632 CCAAGCAAGGAGAATCTGGCGGG + Intergenic
1040596034 8:48838671-48838693 CAATGCAAGGAGGAAGTGCCTGG - Intergenic
1041067467 8:54095999-54096021 CAATGAAATGTGAATGGAGCTGG + Intronic
1042991079 8:74640537-74640559 CAATTCAAAGAGAAAGAGGCAGG + Intronic
1043365363 8:79526615-79526637 CAATGCAGTGAGAGAGGGGCAGG + Intergenic
1044761063 8:95518159-95518181 CACAGCAAGCAGCATGGGGCTGG - Intergenic
1045071868 8:98514666-98514688 AAATGTAAGGTGAGTGGGGCAGG - Intronic
1046813920 8:118563360-118563382 CAATGGAATGAGAAGGGGACTGG - Intronic
1048547659 8:135402727-135402749 CAAGGCAAGTAGAATTGGGGTGG - Intergenic
1050456798 9:5842130-5842152 CAGTGCAAGGGGACTGGAGCAGG + Intergenic
1050562222 9:6845708-6845730 GCATGAAAGGAGAAAGGGGCCGG + Intronic
1052842021 9:33300170-33300192 TAATCCAAGGAGGATGAGGCAGG - Intronic
1053485724 9:38454622-38454644 AAGTGGAAGCAGAATGGGGCTGG - Intergenic
1053519435 9:38763200-38763222 CCAAGCAAGGAGAATTGGGCAGG - Intergenic
1054707972 9:68482281-68482303 CCAACCAAGGAGAAAGGGGCAGG - Intronic
1054957365 9:70928095-70928117 AAATGAAAGGAGCATGGGGTTGG + Intronic
1058729489 9:107836241-107836263 CAGTGCCAGGAGAGTGTGGCTGG - Intergenic
1059176354 9:112173267-112173289 CAAGCCAAAGAGAATGGGGGTGG + Intronic
1059854501 9:118381587-118381609 CAATGCAGGGAGAATGGACTGGG - Intergenic
1060062141 9:120470315-120470337 CAAAGCAATGTGAATGGGGGAGG + Intronic
1061819931 9:133221568-133221590 GACTTCAGGGAGAATGGGGCGGG + Intergenic
1062240723 9:135536377-135536399 GACTGCAAGGAGAAGGGGGCGGG - Intergenic
1062393886 9:136344917-136344939 CCATGCAAGGACCATGGGGTTGG - Intronic
1062701061 9:137903520-137903542 AAAAGCAAGGAGAACGGGACTGG - Intronic
1203425521 Un_GL000195v1:33262-33284 CACTGAAAGAAGAGTGGGGCGGG - Intergenic
1186026494 X:5319377-5319399 CCAAGCAAGGAGAATGGGGCAGG + Intergenic
1186730633 X:12405806-12405828 CAACTCAGGGACAATGGGGCAGG + Intronic
1186877518 X:13830928-13830950 CACTGCAAGGGAAAGGGGGCAGG + Intronic
1188318775 X:28709569-28709591 GAATGAAAAGAGAATGGGGTGGG + Intronic
1188485719 X:30679679-30679701 CAAAGCACGTAGAATGGGGGAGG - Intronic
1189496542 X:41513808-41513830 GAATGCAATGAGATTGGTGCAGG - Intergenic
1190408623 X:50112568-50112590 CAATGATAGGGGAGTGGGGCAGG + Intergenic
1191171469 X:57451818-57451840 CAAAGAAAGCAGGATGGGGCAGG - Intronic
1192055068 X:67765719-67765741 CAAAGCCAGTAGAATGGGGTGGG - Intergenic
1192776235 X:74248526-74248548 AGGTGCTAGGAGAATGGGGCAGG - Intergenic
1196198404 X:112858885-112858907 CAAGGGAAGGGGAATGGGGAAGG - Intergenic
1196709522 X:118748329-118748351 TAAGGAAAGGAGAATAGGGCAGG - Intronic
1199613750 X:149639182-149639204 GAATGCAAGGAGGGTGGGCCTGG + Intergenic
1201319251 Y:12679346-12679368 CAATCAAATGAGAATGGGGGAGG - Intergenic
1201595196 Y:15660488-15660510 CAAAGCAAGAAGAAGGGGGAAGG - Intergenic