ID: 999720591

View in Genome Browser
Species Human (GRCh38)
Location 5:154396467-154396489
Sequence GAGGAAGACCATGATAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 177}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999720582_999720591 20 Left 999720582 5:154396424-154396446 CCCCTTTGTTCTGCAGACAATAC 0: 1
1: 0
2: 1
3: 16
4: 146
Right 999720591 5:154396467-154396489 GAGGAAGACCATGATAGGGTGGG 0: 1
1: 0
2: 0
3: 20
4: 177
999720584_999720591 18 Left 999720584 5:154396426-154396448 CCTTTGTTCTGCAGACAATACAA 0: 1
1: 0
2: 2
3: 27
4: 454
Right 999720591 5:154396467-154396489 GAGGAAGACCATGATAGGGTGGG 0: 1
1: 0
2: 0
3: 20
4: 177
999720581_999720591 30 Left 999720581 5:154396414-154396436 CCAAGGGTGACCCCTTTGTTCTG 0: 1
1: 0
2: 0
3: 14
4: 177
Right 999720591 5:154396467-154396489 GAGGAAGACCATGATAGGGTGGG 0: 1
1: 0
2: 0
3: 20
4: 177
999720583_999720591 19 Left 999720583 5:154396425-154396447 CCCTTTGTTCTGCAGACAATACA 0: 1
1: 0
2: 3
3: 22
4: 259
Right 999720591 5:154396467-154396489 GAGGAAGACCATGATAGGGTGGG 0: 1
1: 0
2: 0
3: 20
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999720591 Original CRISPR GAGGAAGACCATGATAGGGT GGG Intronic
900910479 1:5593818-5593840 GAGGAAGAACAAGAGAGAGTGGG + Intergenic
902793870 1:18787795-18787817 GAAGAAAACCAAGGTAGGGTAGG + Intergenic
905543779 1:38781505-38781527 GAGGAGGAGCATGTTGGGGTGGG - Intergenic
906172808 1:43741961-43741983 GGGGTGGACCATCATAGGGTAGG + Intronic
909395468 1:75166844-75166866 GAGGAAGCCCATTATAGGATTGG - Intergenic
911495929 1:98631071-98631093 GAGGAAAATCATGATTGGGGAGG + Intergenic
913658520 1:120984851-120984873 GAGGAAAACCATAATTGGGTTGG - Intergenic
914009887 1:143767960-143767982 GAGGAAAACCATAATTGGGTTGG - Intergenic
914523133 1:148436090-148436112 GAGGAAAACCATAATTGGGTTGG - Intergenic
914648507 1:149676621-149676643 GAGGAAAACCATAATTGGGTTGG - Intergenic
915772490 1:158442542-158442564 GAGGATGACCATGATGGTGATGG - Intergenic
917191426 1:172422903-172422925 GGGGAAGAGCAGGAAAGGGTGGG + Intronic
920085236 1:203410754-203410776 GATGAAGTCTATGATAGGGAAGG + Intergenic
920195637 1:204224497-204224519 GATGAAGTCCAGGGTAGGGTGGG - Intronic
920429660 1:205909680-205909702 GAGGAATACAAAGAAAGGGTGGG + Intergenic
921734022 1:218606396-218606418 GAGAAGGACCAAGATAGGGGAGG - Intergenic
922019016 1:221685166-221685188 GAGGAAGTCCATGCTAGTATAGG + Intergenic
922462385 1:225823666-225823688 GAGGGAGGCCATGAGAGGGAGGG + Intronic
922782996 1:228268458-228268480 CAGGAAGACCACCCTAGGGTAGG - Intronic
923268911 1:232337188-232337210 TAGGAACAGCATGAGAGGGTGGG + Intergenic
1063406555 10:5801378-5801400 AAGGATGTCCTTGATAGGGTGGG + Intronic
1065976826 10:30849070-30849092 GGGTATGACCATGATAGGTTTGG + Exonic
1067139389 10:43643928-43643950 CAGAAAGACCATCATTGGGTAGG - Exonic
1070641947 10:78176720-78176742 GAGGAAGACTGTGATGGGGAGGG + Intergenic
1071152423 10:82651220-82651242 CAGGAAGACCACTTTAGGGTGGG + Intronic
1071719024 10:88124027-88124049 GAGGATGGGCCTGATAGGGTGGG + Intergenic
1079384990 11:19971054-19971076 GAGGCAGACCATCATGGTGTGGG + Intronic
1079913193 11:26336219-26336241 GAGAAAGACAATGATAGTTTTGG + Intronic
1081462337 11:43283459-43283481 GAAAAAGACCATGATACGGTGGG - Intergenic
1083608704 11:63994663-63994685 GAGGAAGACAAGGAGAGGGTGGG + Intronic
1084809045 11:71601206-71601228 GAGGAAGAATATCACAGGGTGGG + Intronic
1085879116 11:80444625-80444647 GAGGAAGCCCATGATGGAGAAGG + Intergenic
1086928130 11:92663006-92663028 TAGGAAGACTGTGATGGGGTAGG + Intronic
1090182020 11:124708047-124708069 GAGGAGGAACCTGATAGGCTGGG - Intergenic
1090562310 11:127945655-127945677 GAGTAAGATCATGACAGGTTGGG + Intergenic
1091355329 11:134933414-134933436 GAGGAAGACAGTGAAAGGGGAGG - Intergenic
1092539062 12:9408416-9408438 GAGGAAGAATATCACAGGGTGGG + Intergenic
1092556365 12:9566530-9566552 GAGGAAGAATATCACAGGGTGGG - Intergenic
1092556675 12:9568072-9568094 GAGGAAGAATATCACAGGGTGGG - Intergenic
1094160124 12:27381473-27381495 GAGCAGGACCAAGAGAGGGTAGG + Intronic
1094515289 12:31122248-31122270 GAGGAAGAATATCACAGGGTGGG + Intergenic
1094515727 12:31124126-31124148 GAGGAAGAATATCACAGGGTGGG + Intergenic
1100732343 12:97486063-97486085 TAGCAAGACCATGATAGAGTAGG + Intergenic
1100912511 12:99381518-99381540 AAGGAAGACCAGGATAGTGGAGG + Intronic
1101235285 12:102782342-102782364 GAGGAAGATCAGGAGAGTGTAGG - Intergenic
1102634425 12:114310587-114310609 AAGGAAGACAATGAAAGGGGAGG - Intergenic
1104423172 12:128653776-128653798 GAGGTGGCCCATGTTAGGGTTGG + Intronic
1107250319 13:38351712-38351734 AAGGAAGAAAATGATAGAGTAGG + Intronic
1109739840 13:66538802-66538824 GATGAAGACCATTACAGGTTTGG + Intronic
1112225263 13:97533434-97533456 GAGGACCAGCATTATAGGGTGGG - Intergenic
1114333176 14:21658560-21658582 GAGGCAGAGAAAGATAGGGTTGG + Intergenic
1114436950 14:22714444-22714466 TAGGAAAAACATGAGAGGGTGGG - Intergenic
1117037833 14:51745329-51745351 TAGGAAGAACATCACAGGGTGGG + Intergenic
1117395996 14:55311387-55311409 CAGGAAAACAATGATATGGTTGG - Intronic
1117611200 14:57485065-57485087 GAGGAAGACCTAGTTTGGGTAGG + Intronic
1119610496 14:76057667-76057689 GATGTAGACCTTGACAGGGTAGG - Intronic
1122313574 14:100812622-100812644 GGGAAAGCCCATGATAGGCTTGG - Intergenic
1122313688 14:100813222-100813244 GGGAAAGCCCATGATAGGCTTGG + Intergenic
1124687062 15:31791780-31791802 GAGGAGGACCAGGAGAGGGTGGG - Intronic
1125050741 15:35295517-35295539 GAGGAAGACAATGAAAGTGGTGG - Intronic
1127706537 15:61552723-61552745 GAGGAAGACCAGGAAGGAGTTGG + Intergenic
1129400225 15:75277236-75277258 GAGGAACACCAGGATAGGCAAGG - Intronic
1129478280 15:75802479-75802501 GAGAAAGACCAGGAGTGGGTAGG - Intergenic
1132906027 16:2283252-2283274 GAGGAAGAGCAGGATGAGGTAGG + Exonic
1136398042 16:30003768-30003790 GAGGAAGTCCAGGCCAGGGTGGG + Intronic
1137389943 16:48072862-48072884 GAGGGAGACCATCCTGGGGTGGG + Intergenic
1138196371 16:55055099-55055121 TAGGAAGATAATGACAGGGTGGG - Intergenic
1140472755 16:75224438-75224460 GAGGAAGAGCATGGTGGGGCTGG - Intronic
1140612776 16:76621326-76621348 GAGGAAAACAATGGTAGGATGGG - Intronic
1141070319 16:80948671-80948693 GAGGAAGACCTTGGTTGGGAGGG - Intergenic
1142149458 16:88506225-88506247 CAGGGAGACCAGGGTAGGGTTGG + Intronic
1142817200 17:2435785-2435807 GAGGAAGACTCTGGTAGGGGGGG + Intronic
1143555573 17:7657650-7657672 GAGAGAGACCATGGTAGGGCGGG - Exonic
1145759080 17:27415694-27415716 GATGGAGACCCTGATAGGTTTGG + Intergenic
1146643898 17:34563634-34563656 GAGGAAGACCAGGTTGGGGAGGG - Intergenic
1147874855 17:43613923-43613945 GAGGAAGAAGATGATGGGGAAGG + Intergenic
1148171627 17:45525847-45525869 GAGCAAGACCCTGTTTGGGTGGG - Intergenic
1148277743 17:46320562-46320584 GAGCAAGACCCTGTTTGGGTGGG + Intronic
1148288088 17:46414355-46414377 GATGTAGACCAAGATAGGATAGG + Intergenic
1148299950 17:46538417-46538439 GAGCAAGACCCTGTTTGGGTGGG + Intronic
1148310258 17:46631939-46631961 GATGTAGACCAAGATAGGATAGG + Intronic
1148364395 17:47042702-47042724 GAGCAAGACCCTGTTTGGGTGGG + Intronic
1148623999 17:49054960-49054982 GAGGAGGTCCATTAGAGGGTGGG - Exonic
1150402553 17:64870882-64870904 GAGCAAGACCCTGTTTGGGTGGG - Intronic
1151141386 17:71995765-71995787 AAGGAATACCATGATTGAGTTGG - Intergenic
1157518379 18:48327526-48327548 GAGGAAGGCCCTGGGAGGGTGGG - Intronic
1157905455 18:51565506-51565528 GATGTAAACCATGAGAGGGTAGG - Intergenic
1164885449 19:31774734-31774756 GAGGATAACGATGAGAGGGTCGG - Intergenic
1166237139 19:41464771-41464793 TAGGAACAACATGACAGGGTGGG + Intergenic
1167103492 19:47418114-47418136 GAGAAACACCATTATGGGGTAGG + Intronic
1167666057 19:50823339-50823361 GGGGAAGCCCATGGGAGGGTTGG + Intronic
1168076983 19:53985986-53986008 GAGGAAGAGCAAGATGGGGAGGG + Exonic
1168461928 19:56567024-56567046 GAGGAAAACCATGACAGGGCGGG - Intergenic
928710935 2:34004903-34004925 GAGGAGGCCCAAGATAGGTTTGG + Intergenic
929449527 2:42027521-42027543 GAGGAAGAACAAGATGGGATTGG - Intergenic
929585955 2:43114628-43114650 GGGGAAGACCAAGTTAGGGCTGG - Intergenic
929917761 2:46150486-46150508 TAGGGAGACCATTACAGGGTGGG + Intronic
931417600 2:62096447-62096469 AAGGAAGACTATGATTGGGATGG + Intronic
937788225 2:125927889-125927911 GAGGTAGAGCATGCTAGGATTGG - Intergenic
939175746 2:138745803-138745825 GAGGAATTCAATTATAGGGTGGG + Intronic
939821236 2:146959273-146959295 AAGGAAAACCAAGATGGGGTGGG + Intergenic
945186420 2:207144470-207144492 AAGGAACACAAGGATAGGGTTGG - Intronic
947769034 2:232656195-232656217 GGGGCAGACCATGATGAGGTGGG + Intronic
1169135725 20:3195928-3195950 GAGGAAATCCAGGAGAGGGTGGG - Intronic
1176874474 21:14114644-14114666 GAGGAACTCCAGGATAAGGTTGG + Intronic
1177378075 21:20299623-20299645 GAGGAAGCTTATAATAGGGTGGG - Intergenic
1178164451 21:29957348-29957370 GATGGAGAGCATGGTAGGGTAGG + Intergenic
1178638131 21:34322964-34322986 GAAGAAGAGCATGACAGGGCAGG - Intergenic
1179927941 21:44548498-44548520 GAGGAAGCCCAGGACAGTGTGGG + Intronic
1179938068 21:44617439-44617461 GAGGAAGTCCAGGACAGCGTGGG + Intronic
1181458788 22:23074132-23074154 CAGGAAGACCTTGGCAGGGTTGG + Intronic
1181888321 22:26039320-26039342 GAGAAAGATCATGCTAGGATTGG - Intergenic
1182332688 22:29562009-29562031 GTGGAAGACCATGCTGGGGAGGG + Intronic
1185051544 22:48556779-48556801 GAGCAAGGCCATGATCAGGTGGG - Intronic
949836854 3:8279268-8279290 GAGGGAGACCGTGTAAGGGTGGG + Intergenic
952945358 3:38475219-38475241 GAGGGAGAACCTGAGAGGGTGGG - Intronic
953875468 3:46664190-46664212 CAGGCAGACCCTTATAGGGTGGG + Intergenic
956257397 3:67298177-67298199 GCGGCAGACCATGACAGTGTTGG - Intergenic
956674203 3:71719474-71719496 GAGCTAAACCATGATTGGGTAGG + Intronic
958781549 3:98549434-98549456 ACAGAAGACCATGATAGAGTGGG - Intronic
959433076 3:106278745-106278767 GAGGAAGACAATCATGGGGGAGG + Intergenic
960974597 3:123161916-123161938 GAGGGAGACCATGAAAGACTAGG + Exonic
964931874 3:162034807-162034829 GAGGAGGAAAATTATAGGGTGGG - Intergenic
967068560 3:185942117-185942139 TAGGGAGACTATGAAAGGGTGGG + Intergenic
967095520 3:186174407-186174429 GAGGAAGGCAATGAAAGGGAGGG + Intronic
967228741 3:187317945-187317967 GAGCAAGACCCTGTCAGGGTGGG - Intergenic
967530353 3:190542633-190542655 GAGGAAAGCCAAGAGAGGGTAGG - Intronic
969022837 4:4149671-4149693 GAGGAAGAAAATCACAGGGTGGG - Intergenic
969730992 4:8957491-8957513 GAGGAAGAATATCACAGGGTGGG + Intergenic
969790607 4:9491678-9491700 GAGGAAGAATATCACAGGGTGGG + Intergenic
971433665 4:26595645-26595667 GAGGAAGAGAAAGAGAGGGTGGG - Intronic
972913346 4:43846458-43846480 GCGGGAGCCCATGGTAGGGTGGG - Intergenic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
979232084 4:118357529-118357551 GAGGCAGAGCATGATGGGGAGGG - Intergenic
980908784 4:138975278-138975300 GAGGAAGACCTGGAAAGGGAAGG - Intergenic
983648563 4:170016493-170016515 TAGGTAGAGCATGATGGGGTGGG - Intronic
985312377 4:188616418-188616440 GAGGAGGACCAAGTCAGGGTGGG - Intergenic
986355944 5:6926425-6926447 GAGGATGGGCCTGATAGGGTAGG + Intergenic
986367339 5:7045732-7045754 GAGGCAGAGCATGATAGAGAAGG + Intergenic
994775210 5:104030983-104031005 GAGGGAGAATATGATAGGGATGG + Intergenic
995405252 5:111787455-111787477 AAGCAAGCCCATGATAGAGTTGG + Intronic
995481179 5:112594795-112594817 GAGGAAGAGCATGGTGGGTTTGG + Intergenic
995543513 5:113206985-113207007 AAGGAGGACCAAGATAGTGTTGG - Intronic
996801293 5:127406506-127406528 GAGAAAGGCCTTGATAGGCTGGG + Intronic
997399614 5:133592103-133592125 GAGGAAGACCAGGATCTGGGTGG - Intronic
997648166 5:135494983-135495005 GAAGAAGAGCTTGCTAGGGTAGG - Intergenic
997922773 5:137998811-137998833 GAAGAGGACCATGATGGGGATGG - Intronic
998015055 5:138725148-138725170 GAGCAAGACCATGTTAGTGTGGG + Intronic
998395863 5:141817354-141817376 GAGGAAGACCATGTTAACATAGG - Intergenic
999475468 5:151894225-151894247 GAGGAAGAACAAGACAGGTTGGG - Intronic
999720591 5:154396467-154396489 GAGGAAGACCATGATAGGGTGGG + Intronic
1000073015 5:157758558-157758580 GAGGAACATAATGATAGAGTCGG + Exonic
1001225274 5:169939292-169939314 GTGGAAGACAGTGATAGGGAGGG - Intronic
1003285236 6:4728417-4728439 GAGGAAGCCCATGCAAGGATGGG - Intronic
1005372869 6:25153430-25153452 GAGAAAGACCATGATACAGGTGG - Intergenic
1005802459 6:29440740-29440762 GAGGGAGACCATGATCAGGTGGG - Exonic
1006147471 6:31968168-31968190 GAGGGAGACCATGAAGTGGTGGG + Intronic
1006197483 6:32254846-32254868 GAGGAAGAGGATGATGGGGTGGG + Intergenic
1007710779 6:43822722-43822744 GAGCAAGGCAATTATAGGGTGGG + Intergenic
1012114100 6:95271713-95271735 GAGGAAGCCTCTGCTAGGGTTGG + Intergenic
1012531760 6:100245975-100245997 GACCAAGACCATGATAGGGAAGG + Intergenic
1012811067 6:103958901-103958923 GAGCAAGACCATGTTAGAGTGGG - Intergenic
1013934297 6:115574516-115574538 GAAGAAGACCATGCTATGGGAGG + Intergenic
1015389506 6:132665245-132665267 GAGGAAGAGCAAGAAAGGGAAGG - Intergenic
1015630032 6:135222972-135222994 GAGGAAGACAATGATGATGTCGG - Intergenic
1016215614 6:141598559-141598581 GAGCAAGACTATCAGAGGGTTGG + Intergenic
1018833130 6:167461335-167461357 GTGGAAGATCAGGATAGAGTTGG + Intergenic
1019104789 6:169659537-169659559 CAGGAAGAACATGATGGGGAGGG + Intronic
1021332392 7:19354835-19354857 GAGGAAGACAGTGAAAGGGGCGG + Intergenic
1023873197 7:44273677-44273699 GAGTAGGACCCTGACAGGGTGGG - Intronic
1024803282 7:53106224-53106246 GAGGAAGGCCATGAAGGAGTGGG - Intergenic
1028166955 7:87548322-87548344 GAGGAAGAGCAAGAGAGGGAGGG + Intronic
1028951036 7:96635226-96635248 GAGAAAGACCAGGATGGGGGTGG + Intronic
1029576826 7:101408884-101408906 GAGGAAGACCTTGACTGGGGAGG - Intronic
1030087952 7:105833138-105833160 GAAGGGGAACATGATAGGGTGGG - Intronic
1032293471 7:130612484-130612506 GAGGAAGAACAGGATAGGGATGG + Intronic
1037334557 8:17779692-17779714 GAGGAAAACCAAGATAGAGTAGG - Intronic
1038637929 8:29302353-29302375 TAGGAAGAGTATGACAGGGTTGG + Intergenic
1044598261 8:93979332-93979354 AAGGAAGACTATGAAAAGGTGGG - Intergenic
1045691546 8:104764637-104764659 GAGGAAGGGCATGAAAGGCTTGG + Intronic
1047407288 8:124596128-124596150 GAGGAAGAGCAGGTTCGGGTTGG - Intronic
1050033875 9:1414649-1414671 GAGGAAGAATATTATAGGCTGGG + Intergenic
1052259597 9:26498483-26498505 GAGGAAGACCAGTATACTGTTGG + Intergenic
1052450099 9:28618204-28618226 AAGGAAGACCAGGTTGGGGTTGG - Intronic
1052960212 9:34289259-34289281 TAGGGAGACCATGATAGGGCAGG - Intronic
1053153568 9:35757572-35757594 GAGGGAGACCAACACAGGGTGGG + Exonic
1055780504 9:79816088-79816110 GAGGAAGAGCATGGTGGGGTGGG - Intergenic
1056130696 9:83583927-83583949 GAGGAAAACCAGGATCAGGTGGG - Intergenic
1058519287 9:105802937-105802959 GAGGAAGAATATCACAGGGTGGG + Intergenic
1060267838 9:122122493-122122515 GAGGCATCCCAGGATAGGGTGGG + Intergenic
1060755851 9:126212831-126212853 GAGGATGACCATGGGAGGGAGGG + Intergenic
1188400055 X:29733047-29733069 GAGGAAGAGGATGAGAGGGGAGG + Intronic
1190334290 X:49253075-49253097 GAGGAAGACAAAGATGGGGTGGG - Intronic
1191034817 X:56013428-56013450 GAGTAAGACCTTGATACTGTTGG + Intergenic
1193654413 X:84182518-84182540 GAGAGAGACTATGAGAGGGTAGG + Intronic
1195931913 X:110086871-110086893 GAGGAATACCATAATGGGGATGG + Intronic
1197571968 X:128161101-128161123 GAGCAACACAATAATAGGGTGGG - Intergenic
1199301904 X:146222652-146222674 GAGGAAGACCTGGAGAGTGTGGG - Intergenic