ID: 999721081

View in Genome Browser
Species Human (GRCh38)
Location 5:154399785-154399807
Sequence GACTCAGGGCCAGTGTTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999721081_999721089 -6 Left 999721081 5:154399785-154399807 CCTGCCAACACTGGCCCTGAGTC No data
Right 999721089 5:154399802-154399824 TGAGTCTGGCAGGGCACAGAGGG No data
999721081_999721088 -7 Left 999721081 5:154399785-154399807 CCTGCCAACACTGGCCCTGAGTC No data
Right 999721088 5:154399801-154399823 CTGAGTCTGGCAGGGCACAGAGG 0: 1
1: 0
2: 15
3: 224
4: 1487
999721081_999721092 4 Left 999721081 5:154399785-154399807 CCTGCCAACACTGGCCCTGAGTC No data
Right 999721092 5:154399812-154399834 AGGGCACAGAGGGGTTGGTAAGG 0: 1
1: 0
2: 1
3: 39
4: 296
999721081_999721091 -1 Left 999721081 5:154399785-154399807 CCTGCCAACACTGGCCCTGAGTC No data
Right 999721091 5:154399807-154399829 CTGGCAGGGCACAGAGGGGTTGG 0: 1
1: 0
2: 5
3: 56
4: 516
999721081_999721090 -5 Left 999721081 5:154399785-154399807 CCTGCCAACACTGGCCCTGAGTC No data
Right 999721090 5:154399803-154399825 GAGTCTGGCAGGGCACAGAGGGG 0: 1
1: 0
2: 0
3: 46
4: 452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999721081 Original CRISPR GACTCAGGGCCAGTGTTGGC AGG (reversed) Intronic