ID: 999721081

View in Genome Browser
Species Human (GRCh38)
Location 5:154399785-154399807
Sequence GACTCAGGGCCAGTGTTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 262}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999721081_999721092 4 Left 999721081 5:154399785-154399807 CCTGCCAACACTGGCCCTGAGTC 0: 1
1: 0
2: 0
3: 23
4: 262
Right 999721092 5:154399812-154399834 AGGGCACAGAGGGGTTGGTAAGG 0: 1
1: 0
2: 1
3: 39
4: 296
999721081_999721090 -5 Left 999721081 5:154399785-154399807 CCTGCCAACACTGGCCCTGAGTC 0: 1
1: 0
2: 0
3: 23
4: 262
Right 999721090 5:154399803-154399825 GAGTCTGGCAGGGCACAGAGGGG No data
999721081_999721091 -1 Left 999721081 5:154399785-154399807 CCTGCCAACACTGGCCCTGAGTC 0: 1
1: 0
2: 0
3: 23
4: 262
Right 999721091 5:154399807-154399829 CTGGCAGGGCACAGAGGGGTTGG 0: 1
1: 0
2: 5
3: 56
4: 516
999721081_999721088 -7 Left 999721081 5:154399785-154399807 CCTGCCAACACTGGCCCTGAGTC 0: 1
1: 0
2: 0
3: 23
4: 262
Right 999721088 5:154399801-154399823 CTGAGTCTGGCAGGGCACAGAGG 0: 1
1: 0
2: 15
3: 224
4: 1487
999721081_999721089 -6 Left 999721081 5:154399785-154399807 CCTGCCAACACTGGCCCTGAGTC 0: 1
1: 0
2: 0
3: 23
4: 262
Right 999721089 5:154399802-154399824 TGAGTCTGGCAGGGCACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999721081 Original CRISPR GACTCAGGGCCAGTGTTGGC AGG (reversed) Intronic
900733663 1:4280778-4280800 AACTCAGGGCCAGTGCTGCTAGG - Intergenic
902625468 1:17673721-17673743 GGCTCAGGGGCTGGGTTGGCTGG + Intronic
902712453 1:18249719-18249741 GAATCAGAGCAACTGTTGGCAGG - Intronic
902879198 1:19359842-19359864 CTCTGAGTGCCAGTGTTGGCCGG - Intronic
903364888 1:22800048-22800070 AGCTCAGGGCCAGGGTTGCCAGG - Intronic
903569469 1:24293782-24293804 GCCCCAGGGCCAGGGGTGGCAGG + Intergenic
904043474 1:27597395-27597417 GACGCAGGGCCTGTGTAGACAGG + Intronic
904499562 1:30906379-30906401 GGCTCAGACCCAGTGTTGGGTGG - Intronic
904630193 1:31835488-31835510 GAGTCAGTGACAGTGGTGGCAGG - Intergenic
905050574 1:35047439-35047461 GATGCAGGGCCAGTGTGTGCAGG - Intergenic
905466110 1:38154818-38154840 GACTCAGGGCCAGTGAGTGGTGG + Intergenic
906320622 1:44813352-44813374 GACTCAGGGCTGGCGTTTGCAGG + Exonic
906372886 1:45269645-45269667 GTCTCTGGGCCTGTGTTGGCAGG - Intronic
906699853 1:47849955-47849977 GTCTGTGGGCCAGTGCTGGCTGG - Intronic
906991739 1:50746808-50746830 GCCTCTGGGCCAGTGATGGCAGG - Intronic
907159480 1:52360106-52360128 GTCTCAGGGCTCCTGTTGGCTGG + Exonic
907334066 1:53688949-53688971 GACTCTGGGCCAGGCATGGCTGG + Intronic
908885153 1:68780642-68780664 GTCTCAGGGCCTGTGATGGGAGG - Intergenic
909574513 1:77159031-77159053 GCCTCAGGGCCTGTGATGGGAGG - Intronic
910273286 1:85420182-85420204 GCCTCAGGGCCTGTGATGGGAGG + Intronic
910357621 1:86377817-86377839 GCCTCTGGGCCAGTGATGGGAGG + Intronic
910770468 1:90825858-90825880 AACTCAGAGTCAGTGTTGGAAGG + Intergenic
912135522 1:106656300-106656322 GTCTCAGGGCCTGTGATGGGAGG + Intergenic
912681155 1:111729815-111729837 CCCCCAGGGCCAGGGTTGGCAGG - Intronic
916858437 1:168776276-168776298 GAATGAAGGCCAGTGTTGACTGG - Intergenic
917022274 1:170602091-170602113 GCCTCTGGGCCTGTGTTGGGAGG + Intergenic
918831617 1:189405590-189405612 GCCTCAGGGCCTGTGATGGGAGG + Intergenic
919757315 1:201074189-201074211 GACTCAGTGACAGGGTTGGGAGG + Intronic
920305209 1:205014231-205014253 GACCCAGGGTCAGTGTCTGCGGG - Intronic
920556558 1:206908871-206908893 CACTCAGGGCCACTGATGGTTGG - Intronic
922673433 1:227532560-227532582 GACTCAGGGCTGTTGGTGGCAGG - Intergenic
923808685 1:237288662-237288684 GACTCAGGGCTGTTGTTGGGGGG - Intronic
924241389 1:242044648-242044670 GCCTCAGGGCCTGTGATGGGGGG - Intergenic
1063154008 10:3361830-3361852 GCCTCTGGGCCTGTGATGGCAGG - Intergenic
1063728529 10:8668219-8668241 GACCCAGGCCCAGTTTTGTCTGG - Intergenic
1068312275 10:55293321-55293343 GCCTCAGGGCCTGTGATGGATGG + Intronic
1069863893 10:71488386-71488408 GACTCAGGTCCAAGATTGGCAGG - Intronic
1070479701 10:76870235-76870257 GACTCAGGGTCAGCGTGGGAAGG - Intronic
1071020484 10:81048532-81048554 GACTCAGGCCATGTGTTGGTAGG + Intergenic
1071277197 10:84066074-84066096 GCCTCAGGGCCAGTGCTCACAGG - Intergenic
1076135271 10:128041225-128041247 GAGTCAGGGTCAGCCTTGGCTGG + Intronic
1076406216 10:130213999-130214021 GCCTCGGGGCCAGTGTGGCCCGG + Intergenic
1076676125 10:132148662-132148684 GACACAGGGCCAGGGATGGCAGG - Intronic
1078860131 11:15239159-15239181 GACACAGGGCAAGAGCTGGCTGG + Intronic
1080451355 11:32381351-32381373 GGCGCAGGGCCAGTGCAGGCCGG + Intergenic
1083257991 11:61508523-61508545 GTCTCAGTGCCAGGCTTGGCCGG + Intergenic
1083716978 11:64583133-64583155 GAGTCAGTGCCTGTGTGGGCAGG + Intergenic
1083783398 11:64930099-64930121 GACTCAGTGGCAGAGGTGGCTGG + Intronic
1088977117 11:114825623-114825645 GACTCAGGGCCACCATTTGCTGG + Intergenic
1090685746 11:129116770-129116792 GACCCAAGGACAGTGTTGTCAGG - Intronic
1090973237 11:131660507-131660529 GACCCAGGGTCAGTGCCGGCTGG - Intronic
1091629669 12:2150166-2150188 GACGCAGTTCCAGTTTTGGCTGG + Intronic
1093207019 12:16263625-16263647 AACTCTGGGCCTGTGATGGCAGG - Intronic
1093353066 12:18128002-18128024 GCCTCAGGGCCTGTGATGGGAGG - Intronic
1093843299 12:23933226-23933248 GATTCAGGTCCAGGGTTAGCTGG - Intronic
1094081086 12:26536691-26536713 TACACCAGGCCAGTGTTGGCAGG + Intronic
1094743364 12:33314802-33314824 GCCTCAGGGCCTGTGGTGACAGG + Intergenic
1095864508 12:46956810-46956832 GACCCATGGCCACTGTTGGCAGG - Intergenic
1096195090 12:49644562-49644584 GCCTCAGGGCCAGGGCAGGCAGG - Exonic
1098588340 12:72182484-72182506 GACTCAGGACCAAAATTGGCTGG + Intronic
1098610680 12:72453669-72453691 GCCTCAGGGCCTGTGATGGGAGG - Intronic
1100376051 12:94017386-94017408 GCCTCTGGGCCTGTGATGGCAGG - Intergenic
1100597880 12:96087446-96087468 GCCTCTGGGCCTGTGTTGGGAGG - Intergenic
1101358975 12:104008690-104008712 GCCTCCGGGCCTGTGATGGCAGG - Intronic
1102968374 12:117146760-117146782 AGCTAAGGGCCAGTGTTGGAAGG - Intronic
1103035359 12:117652150-117652172 GACTCAGGGGCAGTGTGGGAGGG + Intronic
1104973655 12:132542537-132542559 GAGGCAGGGCCAGTGAGGGCCGG - Intronic
1109252216 13:60032672-60032694 GCCTCTGGGCCAGTGATGGGAGG + Intronic
1109344626 13:61099914-61099936 GCCTCTGGGCCAGTGATGACAGG - Intergenic
1110566279 13:76960156-76960178 GCCTCTGGGCCTGTGTTGGGAGG + Intergenic
1111358734 13:87146073-87146095 GCCTCTGGGCCTGTGATGGCAGG - Intergenic
1113917426 13:113882911-113882933 GATTCGCGGCCAGTTTTGGCGGG + Intergenic
1116369307 14:44109627-44109649 GCCTCAGGGCCTGTGATGGGAGG - Intergenic
1116780818 14:49236097-49236119 GCCTCTGGGCCTGTGTTGGGAGG - Intergenic
1118289120 14:64504221-64504243 GACTCAGGGCCAGAGGCAGCAGG + Intronic
1118445438 14:65846963-65846985 GACTCAAGGAAAGTGTGGGCGGG + Intergenic
1118615020 14:67569299-67569321 CACCCAGGGCCAGGGTTGGCTGG + Intronic
1125450250 15:39800392-39800414 CAGTCAGGGTCAGTGTTGGCTGG - Intronic
1126349244 15:47727505-47727527 ACCTCAGGGCTACTGTTGGCAGG + Intronic
1128119823 15:65137305-65137327 GCCTCTGGGCCTGTGTTGGGAGG + Intergenic
1128160378 15:65419853-65419875 GACTCAAGAACAGTGTTGGGAGG + Intronic
1128565811 15:68699864-68699886 GGCTCAGGGCCATGGTGGGCTGG + Intronic
1129701663 15:77771890-77771912 AACTCAGGGCCATTGAGGGCAGG - Intronic
1131360817 15:91789054-91789076 GAATCAGGCCCATGGTTGGCTGG - Intergenic
1131535748 15:93236317-93236339 GACCCAGGCTCAGTGTGGGCTGG + Intergenic
1135714325 16:24748450-24748472 GAGTCATGGCCACAGTTGGCAGG + Intronic
1137451928 16:48584040-48584062 GTCTCTGGGCCAGTGTGGACAGG - Intronic
1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG + Exonic
1138506929 16:57483047-57483069 GACTCAGGGCCGGAGTGAGCTGG - Intronic
1138555742 16:57770373-57770395 GACCCAGGGCAAGTTTTGTCTGG - Intronic
1139940650 16:70602991-70603013 CACTCAGGGCTGGGGTTGGCGGG - Intronic
1141313124 16:82934438-82934460 GCCTCAGGGCCTGTGATGGCAGG + Intronic
1141659934 16:85436363-85436385 GACTCAGGGCTAGGATGGGCTGG - Intergenic
1144447484 17:15344404-15344426 GAATAAGAGCCAGTGTAGGCTGG - Intergenic
1145285014 17:21498914-21498936 GCCTCTGGACCAGTTTTGGCTGG + Intergenic
1145392510 17:22466833-22466855 GCCTCTGGACCAGTTTTGGCTGG - Intergenic
1146567384 17:33925026-33925048 AACTCAGGGCCAGTGTACCCAGG + Intronic
1146685110 17:34836342-34836364 GACCCATGGCTAGGGTTGGCAGG - Intergenic
1149116008 17:53097498-53097520 GACTCTGGGCCTGTGATGGGTGG - Intergenic
1149587417 17:57801483-57801505 GCCTCAGGGCCTGTGATGGGTGG - Intergenic
1150687337 17:67331445-67331467 GCCTCAGGGCCTGTGATGGGAGG - Intergenic
1151415582 17:73960594-73960616 GCCTCTGGGCCTGTGATGGCAGG - Intergenic
1151960842 17:77404870-77404892 GACTCAGTGACAGTGGTTGCTGG + Intronic
1152548012 17:81012680-81012702 GCCTCAGGGCCTGTGATGGGAGG - Intergenic
1152574883 17:81135600-81135622 GAAACAGGGTCAGTGTGGGCAGG + Intronic
1152778754 17:82217291-82217313 GAGGCAGGGCCAGTGCTGCCAGG + Intergenic
1156457712 18:37304009-37304031 GACCCAGGGCCAATGTTGCAAGG + Intronic
1156904504 18:42337158-42337180 GCCTCTGGGCCAGTGATGGGAGG + Intergenic
1159066026 18:63568507-63568529 GACTCAGGGCCTCTGTTCTCTGG + Intergenic
1159767237 18:72505123-72505145 GCCTCAGGGCCAAGGTTGTCAGG - Intergenic
1160231490 18:77052790-77052812 GACTCAGGCCCGGTGTTGCTGGG - Intronic
1161023100 19:2020757-2020779 GAGTGAGTCCCAGTGTTGGCTGG - Intronic
1161358914 19:3835061-3835083 AGCTCAGGTCCAGTGGTGGCTGG - Intronic
1161662273 19:5554211-5554233 GACCAAGGCCCAGTGGTGGCAGG + Intergenic
1162386982 19:10365608-10365630 GACTCAGGGCCAGGGTCTGTAGG + Exonic
1162792294 19:13069423-13069445 GGGGCAGGGACAGTGTTGGCTGG - Intronic
1163230049 19:15995620-15995642 GACTCTGGGCCTGTGATGGGAGG - Intergenic
1165230436 19:34383205-34383227 GCCACAGGGCCAGTTTTGGCTGG + Intronic
1165422625 19:35729894-35729916 GACTCAGTGACAGTGGTGCCTGG + Intronic
1165620177 19:37239542-37239564 GACTAAATGCCAGTGTTGGTGGG + Intronic
1168277529 19:55285778-55285800 AGCTCAGGGCCAGAGCTGGCAGG + Intronic
1168293512 19:55368506-55368528 CACTCATGGCCAGGGTGGGCAGG + Exonic
1168458724 19:56536962-56536984 GGCTCAGGGCCTGTGTTCACTGG - Intergenic
925144310 2:1570588-1570610 GTCTCAGGGACTGTGATGGCCGG + Intergenic
927396146 2:22654295-22654317 GCCTCAGGGCCTGTGATGGGTGG - Intergenic
927695316 2:25235869-25235891 GACGCATGACCAGTGTTGGCTGG - Intronic
927810510 2:26178017-26178039 GACCCAGGGCCAGAGGAGGCAGG - Intronic
928494794 2:31820533-31820555 GCCTCAGGGCCTGTGATGGGAGG + Intergenic
929954262 2:46443459-46443481 GAGGCAGAACCAGTGTTGGCGGG - Intronic
930442964 2:51432150-51432172 GCCTCAGGGCCTGTGTTGAGAGG - Intergenic
931041388 2:58305002-58305024 GACTCTGAGCCAGTGATGGGAGG - Intergenic
932708556 2:74046326-74046348 GACTCAGGGCCAGTGTACCATGG + Exonic
932891254 2:75598904-75598926 CCCTCAGGGCCAGTGTTGTCAGG - Intergenic
933051695 2:77610000-77610022 GACTCCAGGCAAGTGATGGCTGG - Intergenic
934569716 2:95361540-95361562 GACTCAGGTCCAGTGACAGCAGG - Intronic
935240033 2:101170377-101170399 GCCTCAGGGCCTGTGATGGGAGG - Intronic
936156604 2:110051058-110051080 GACACAGGGACACTGGTGGCTGG + Intergenic
936188086 2:110320386-110320408 GACACAGGGACACTGGTGGCTGG - Intergenic
936733686 2:115413788-115413810 AACTCAGGGCCAGTTATGGATGG + Intronic
936822774 2:116542868-116542890 GCCTCAGGGCCTGTGATGGTAGG + Intergenic
937925516 2:127164948-127164970 CTCTCAGGGCCAGTGGTGGCTGG - Intergenic
939847839 2:147269164-147269186 GACTCTGGGCCTGTGATGGGAGG + Intergenic
940790821 2:158028018-158028040 GCCTCTGGGCCTGTGTTGGGAGG + Intronic
942601296 2:177643730-177643752 GACTCTGGGCCTGTGATGGGAGG - Intronic
946006090 2:216526172-216526194 GTCACAGGGCCTGTGCTGGCGGG + Intronic
946010919 2:216562886-216562908 GATTCAGGGCCGTTGTAGGCAGG - Intronic
946431889 2:219630689-219630711 GACTCAGGGCCTGGTTTGGAGGG - Intronic
946968605 2:225067309-225067331 GCCTCTGGGCCAGTGATGGAAGG - Intergenic
948452003 2:238081541-238081563 GACTCTGGGCCAGTGATGATGGG + Intronic
1168859700 20:1037110-1037132 GACTCATGGCCAGCATTGGCAGG + Intergenic
1171818761 20:29813037-29813059 GCCTCAGGGCCTGTGATGGGGGG + Intergenic
1171899036 20:30839988-30840010 GCCTCAGGGCCTGTGATGGGGGG - Intergenic
1172783266 20:37449892-37449914 GATTTGGGGCCAGTGTTGACTGG + Intergenic
1175379673 20:58554096-58554118 GCCTCAGGGCCTGTGGTTGCAGG - Intergenic
1177484982 21:21745768-21745790 GCCTCAGGGCTAGTGATGGGAGG - Intergenic
1177504346 21:22000969-22000991 GCCTCAGGGCCTGTGATGGGAGG + Intergenic
1180007013 21:45027536-45027558 GACTCAGGGCCCATGTGTGCAGG - Intergenic
1180322737 22:11337726-11337748 GCCTCAGGGCCTGTGATGGGGGG + Intergenic
1181441210 22:22936006-22936028 CAATCAGGGCCACTGCTGGCTGG - Intergenic
1182115862 22:27756047-27756069 TACTCATAGCCAGCGTTGGCAGG - Intronic
1183476318 22:38038081-38038103 GCCTGAGAGCCAGTGTTGGGGGG + Intronic
1183727832 22:39599283-39599305 GACTCTGGCCCAGTGCTGCCTGG - Intronic
1183748791 22:39707393-39707415 GCCTCAGTGTCACTGTTGGCTGG + Intergenic
1184510529 22:44930665-44930687 GATTCAGGGCCCCTGGTGGCAGG - Intronic
1184891586 22:47382714-47382736 GGCTCAGAGCCAATGTGGGCTGG - Intergenic
1185409373 22:50674272-50674294 GGCTCAGGGCCAGTGCTGGGGGG - Intergenic
949930163 3:9072145-9072167 GACTCAGGAGCAGTGCTGACTGG + Intronic
950776049 3:15351534-15351556 GACTCTGGGCCTGTGATGGGAGG - Intergenic
952221438 3:31327574-31327596 GCCTCTGGGCCAGTGATGGGAGG + Intergenic
953550457 3:43898527-43898549 CACTCAGGGTCAGACTTGGCTGG - Intergenic
953666410 3:44929236-44929258 GACCCAGGGTCAGTGTTGCTGGG - Intronic
953972682 3:47359456-47359478 GCCTCAGGGCCTGTGATGGGAGG - Intergenic
954687534 3:52378859-52378881 CACTCAGGGCCTGTTTGGGCAGG - Intronic
956491496 3:69777095-69777117 TAGTCAGGGTCAGTGTTGGGTGG + Intronic
956714221 3:72063875-72063897 GCCTCAGGGCCTGTGATGGGAGG + Intergenic
959453523 3:106532104-106532126 GCCTCAGGGCCTGTGATGGGAGG - Intergenic
959507878 3:107176009-107176031 GACTCAGGGCCTGTGATGGGAGG - Intergenic
960869262 3:122232602-122232624 GAGGCAGGGCCAGTGTATGCAGG + Intronic
960901498 3:122558652-122558674 GACATAGGGCCAATGTTTGCTGG - Intronic
963878373 3:150501459-150501481 GACTCTGGGCCTGTGATGGGAGG + Intergenic
966086797 3:176078202-176078224 GACTCTGGGCCAGAGCTGGCGGG + Intergenic
967777065 3:193395564-193395586 GCCTCTGGGCCTGTGATGGCAGG + Intergenic
969871551 4:10107852-10107874 GAACCAGGCCCTGTGTTGGCAGG - Intronic
970635565 4:18005845-18005867 GCCTCTGGGCCTGTGATGGCAGG + Intronic
972132744 4:35858786-35858808 GCCTCTGGGCCTGTGATGGCAGG - Intergenic
972224594 4:36997745-36997767 GACTCTGGACAAGTGTTGGAGGG + Intergenic
972367753 4:38392384-38392406 GTCTCTGGGCCTGTGTTGGGAGG - Intergenic
974214565 4:58828318-58828340 GGCTCTGGGCCAGTGATGGTAGG + Intergenic
975609837 4:76193011-76193033 GTCTCAGGGCCTGTGATGGAAGG - Intronic
976076214 4:81302004-81302026 GGTACAGGGCCAGTGGTGGCTGG - Intergenic
977670073 4:99685297-99685319 GCCTCAGGGCCTGTGATGGGAGG - Intergenic
980310760 4:131126312-131126334 GACTCTGGGCCTGTGGTGGCAGG + Intergenic
980337378 4:131494409-131494431 GCCTCTGGGCCTGTGTTGGGGGG + Intergenic
981611851 4:146601540-146601562 GACCCAGTGCCTGTGATGGCTGG - Intergenic
982019607 4:151190425-151190447 GTCTCAGGGCCTGTGATGGGAGG - Intronic
983767751 4:171507035-171507057 GCCTCAGGGCCAGTGGAGGCAGG - Intergenic
985362713 4:189192662-189192684 GCCTGATGGGCAGTGTTGGCTGG - Intergenic
985586450 5:740118-740140 GACTCAGGGGGAGTGGTGGGAGG + Intronic
985600094 5:823899-823921 GAGTCTGGGCCAGGGTGGGCTGG + Intronic
985601038 5:832295-832317 GACTCAGGGGGAGTGGTGGGAGG + Intronic
985646684 5:1088273-1088295 GACTCAGGGCCGCGGCTGGCGGG + Intronic
985719079 5:1480001-1480023 GACTCAGGGCCTGTGCTGCCTGG - Intronic
987087898 5:14487213-14487235 GACTAAGGGCCAGTGTCCACAGG - Intronic
987788552 5:22534350-22534372 GACTCAGGGGAAGTGTGGGAAGG - Intronic
988858588 5:35253158-35253180 GCCTCAGGGCCGGTGATGGAAGG + Intergenic
990072863 5:51806550-51806572 CACTCAAGGCCACTGTTGACTGG + Intergenic
990124896 5:52502670-52502692 GTCTCTGGGCCTGTGTTGTCTGG + Intergenic
991976670 5:72189962-72189984 GGCCCAGGTCCAGTGTTGACAGG + Intronic
993198582 5:84782420-84782442 GGCTCAGGGCCTGTGATGGGAGG + Intergenic
993569894 5:89524203-89524225 GCCTCAGGGCCTGTGATGGAAGG + Intergenic
993799837 5:92319400-92319422 GTCTCAGGGCCTGTGATGGGAGG - Intergenic
994325725 5:98442668-98442690 GCCTCAGGGCCTGTGATGGGAGG + Intergenic
995591028 5:113699624-113699646 GCCTCAGGGCCTGTGATGGGAGG + Intergenic
995761328 5:115565391-115565413 ACCTCAGGGCCTGTGTTGGGAGG - Intergenic
996196292 5:120611412-120611434 GCCTCTGGGCCTGTGATGGCAGG - Intronic
997096964 5:130924043-130924065 GACTCAGGGCCAGTGAGATCTGG - Intergenic
997410284 5:133685734-133685756 GGCTTATGGCCAGTGCTGGCAGG + Intergenic
997429458 5:133827419-133827441 AGCTCAGGGGCAGTGTTGGGAGG - Intergenic
998366838 5:141637493-141637515 GACCCAGGGCCGGAGTTGCCCGG + Exonic
998507728 5:142685595-142685617 GATTCAGGGCCAGTGTCAGGCGG + Intronic
999244517 5:150146888-150146910 GACTGAGGGGCAGTGTATGCGGG + Intronic
999721081 5:154399785-154399807 GACTCAGGGCCAGTGTTGGCAGG - Intronic
999727088 5:154446234-154446256 GACTCCGGGCCTGGGTTGCCAGG - Exonic
1000431042 5:161152736-161152758 GACTCTGGGGCTGTCTTGGCTGG - Intergenic
1000971705 5:167722039-167722061 GTCCCAGGGCCAATGATGGCTGG + Intronic
1001578046 5:172777618-172777640 GGCTTGGGGCCATTGTTGGCAGG - Intergenic
1001701846 5:173712491-173712513 GACTGAGTGCCAGTGCTGGTGGG + Intergenic
1001795467 5:174498759-174498781 GCCTCAGGGCCTGTGATGGAAGG - Intergenic
1002337919 5:178493268-178493290 GACTGAGGTTCAGTGTGGGCTGG - Intronic
1002772363 6:300871-300893 GACTCAGGGGCAACCTTGGCAGG + Intronic
1004565207 6:16789516-16789538 GCCTCAGGGCCTGTGATGGGAGG + Intergenic
1006277884 6:33020741-33020763 AACTCAGGACCAGTGGTGGAAGG - Intergenic
1006811705 6:36824447-36824469 GACTTGAGGGCAGTGTTGGCAGG - Intronic
1006841718 6:37032551-37032573 GAGTCAGGGGCAGAGTTGCCAGG - Intergenic
1007285563 6:40744982-40745004 CATGCAGGGCCAGTGCTGGCTGG - Intergenic
1010348426 6:74841089-74841111 GCCTCAGGGCCTGTGATGGGAGG - Intergenic
1010590595 6:77707656-77707678 GACTCTGGGCCTGTGATGGAAGG - Intronic
1011378679 6:86719121-86719143 GCCTCTGGGCCAGTGATGGTAGG + Intergenic
1013910648 6:115272439-115272461 GCCTCAGGGCCTGTGATGGGAGG - Intergenic
1014895160 6:126892588-126892610 GCCTCAGGGCCAGTGATGGGAGG - Intergenic
1015375507 6:132505322-132505344 CTCTAAGGGACAGTGTTGGCAGG + Intronic
1017169042 6:151438699-151438721 GAGGCAGGGACAGTGTGGGCTGG - Intronic
1018477766 6:164159800-164159822 GTCTCAGGGCCTGTGATGGGAGG + Intergenic
1019224620 6:170499980-170500002 GGCTGAGGGCCTGTGTTAGCCGG - Intergenic
1019426870 7:982158-982180 GCCTCAGGGCCAGGGCTGGGCGG - Intergenic
1019751935 7:2736229-2736251 GACTCTGGGCTCGTCTTGGCAGG - Intronic
1022975662 7:35553638-35553660 GACTCACTGTCAGTGTTGACAGG - Intergenic
1023275631 7:38516245-38516267 GCCTCAGGGCCTGTGATGGAAGG - Intronic
1033982138 7:147178427-147178449 GACTAAAACCCAGTGTTGGCAGG - Intronic
1035304737 7:157924426-157924448 GACTCAGAACCAGTGTCGGGAGG - Intronic
1035371379 7:158381068-158381090 GCCTCAGGGCCTGTGATGGGAGG + Intronic
1035667659 8:1390965-1390987 GACCCAGGGTCTGTGCTGGCAGG + Intergenic
1037081906 8:14797707-14797729 GCCTCAGGGCCTGTGATGGGAGG - Intronic
1040341758 8:46444625-46444647 GACTCAGGGGCCGTGGAGGCAGG - Intergenic
1042989155 8:74619857-74619879 GACTCTGGGCAACTGTTGGAAGG - Intronic
1045255183 8:100513972-100513994 GACTCTGGGTCAGAGTTGTCTGG - Intronic
1045320647 8:101079552-101079574 GAATCAGGGCCAGTGCTTGCAGG + Intergenic
1047538949 8:125745345-125745367 TCCTCAGCGCCAGTGTTGACTGG - Intergenic
1048137368 8:131759527-131759549 GCCTCAGGGCCTGTGATGGGAGG - Intergenic
1048729237 8:137419042-137419064 GACTCTGGGCCTGTGATGGAAGG + Intergenic
1049096015 8:140548546-140548568 GACCCTGGGACAGTGTTAGCAGG + Intronic
1049531370 8:143157184-143157206 AACTCAGGGCCAGGAGTGGCCGG + Intergenic
1050583453 9:7085230-7085252 GGCTCAGGGCCATTGTTGTGTGG + Intergenic
1051893661 9:21967399-21967421 GACTATGGGCCAGGGTTGGCTGG + Exonic
1055480380 9:76703643-76703665 GACTCAGGGCCTGGGTGGTCTGG - Exonic
1057542456 9:95988099-95988121 GCCTCAGGGCCTGTGATGGGAGG + Intronic
1060393724 9:123300818-123300840 GACTCAGGGCCTCTGGTGTCTGG + Intergenic
1061183354 9:129037673-129037695 GACTGAGGCCCACTGTTTGCGGG - Intronic
1062137150 9:134935221-134935243 GACGGATGGCCAGTGTTTGCAGG + Intergenic
1062624363 9:137436207-137436229 GGCCCAGGGCCAGTGTGGTCTGG + Exonic
1203370425 Un_KI270442v1:298303-298325 GCCTCAGGGCCTGTGATGGGGGG + Intergenic
1185797685 X:2981132-2981154 GCCTCAGGGCCTGTGATGGGAGG - Intergenic
1190959094 X:55227931-55227953 GTCTCTGGGCCTGTGATGGCAGG - Intronic
1192795985 X:74424035-74424057 GACTCAGGGGGAGGGCTGGCTGG + Intronic
1193283488 X:79684113-79684135 GCCTCAGGGCCTGTGATGGCAGG - Intergenic
1193570856 X:83141112-83141134 GACTCTCAGCCAGTGTGGGCAGG + Intergenic
1194013981 X:88597075-88597097 GACTCAGGGCAAAGGTTGGGAGG - Intergenic
1195525962 X:105889863-105889885 GCCTCTGGGCCTGTGATGGCAGG + Intronic
1195709081 X:107759869-107759891 GCCTCAGGGCCAGCCTGGGCTGG + Intronic
1196503294 X:116411041-116411063 GCCTCTGGGCCTGTGATGGCAGG - Intergenic
1198226860 X:134653227-134653249 GGCTCAGGGGCCATGTTGGCAGG + Intronic
1198601363 X:138287427-138287449 GACTCAGGGACAGTGTCAACAGG + Intergenic
1199091761 X:143701597-143701619 GCCTCAGGGCCTGTGATGGGAGG - Intergenic
1200332367 X:155311032-155311054 GTCTCAGGGCCTGTGGTGGAAGG + Intronic
1201067886 Y:10116773-10116795 GCCTCAGGGCCTGTGATGGGGGG - Intergenic
1202099774 Y:21294955-21294977 GCCTCAGGGCCTGTGATGGGAGG + Intergenic