ID: 999722304

View in Genome Browser
Species Human (GRCh38)
Location 5:154407806-154407828
Sequence AGTGCTGAAGAGTCCACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999722304_999722308 2 Left 999722304 5:154407806-154407828 CCCACTGTGGACTCTTCAGCACT 0: 1
1: 0
2: 1
3: 9
4: 181
Right 999722308 5:154407831-154407853 GGAAGAACTAGGTAGCAACAAGG No data
999722304_999722309 21 Left 999722304 5:154407806-154407828 CCCACTGTGGACTCTTCAGCACT 0: 1
1: 0
2: 1
3: 9
4: 181
Right 999722309 5:154407850-154407872 AAGGAAATTCAGCTGTTTCCTGG 0: 1
1: 1
2: 2
3: 23
4: 248
999722304_999722307 -9 Left 999722304 5:154407806-154407828 CCCACTGTGGACTCTTCAGCACT 0: 1
1: 0
2: 1
3: 9
4: 181
Right 999722307 5:154407820-154407842 TTCAGCACTCAGGAAGAACTAGG 0: 1
1: 0
2: 0
3: 40
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999722304 Original CRISPR AGTGCTGAAGAGTCCACAGT GGG (reversed) Intronic