ID: 999722304

View in Genome Browser
Species Human (GRCh38)
Location 5:154407806-154407828
Sequence AGTGCTGAAGAGTCCACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999722304_999722308 2 Left 999722304 5:154407806-154407828 CCCACTGTGGACTCTTCAGCACT 0: 1
1: 0
2: 1
3: 9
4: 181
Right 999722308 5:154407831-154407853 GGAAGAACTAGGTAGCAACAAGG No data
999722304_999722307 -9 Left 999722304 5:154407806-154407828 CCCACTGTGGACTCTTCAGCACT 0: 1
1: 0
2: 1
3: 9
4: 181
Right 999722307 5:154407820-154407842 TTCAGCACTCAGGAAGAACTAGG 0: 1
1: 0
2: 0
3: 40
4: 335
999722304_999722309 21 Left 999722304 5:154407806-154407828 CCCACTGTGGACTCTTCAGCACT 0: 1
1: 0
2: 1
3: 9
4: 181
Right 999722309 5:154407850-154407872 AAGGAAATTCAGCTGTTTCCTGG 0: 1
1: 1
2: 2
3: 23
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999722304 Original CRISPR AGTGCTGAAGAGTCCACAGT GGG (reversed) Intronic
900217127 1:1487512-1487534 AGTGCTCAAGAGTCCACGCAAGG - Intronic
902885208 1:19399923-19399945 AGAGCTGGGCAGTCCACAGTTGG - Intronic
903032733 1:20475370-20475392 AGTGGTTAAGAGTTCAGAGTGGG + Intergenic
903918181 1:26779793-26779815 AGTCCAGAAGGGTACACAGTGGG - Exonic
904288487 1:29469078-29469100 AGTGTTGCAGAGCCCAGAGTGGG + Intergenic
906581197 1:46936387-46936409 TGTGCTGAAGGTTCCAAAGTGGG + Intronic
907487704 1:54788766-54788788 ACAGCTGAGGAGGCCACAGTCGG - Intronic
908445041 1:64191896-64191918 AGTGGTGCAGAGCCAACAGTTGG - Intergenic
910279208 1:85480088-85480110 AGTGTTGAACCATCCACAGTGGG - Intronic
910321572 1:85951306-85951328 AGTGCTGAAAAGGCTAAAGTAGG + Intronic
910552683 1:88494435-88494457 CGTGCTGAATATTCCACATTAGG - Intergenic
912049851 1:105514693-105514715 AGGGTTTAAGAGTCCACAATAGG - Intergenic
912606316 1:110993041-110993063 AGGGCTGAATAGTCCACTCTAGG + Intergenic
915130236 1:153690613-153690635 AGTGCTGGAGAGTTCCCAGCAGG + Intronic
915432818 1:155879681-155879703 AGTTCTGAAGACTGTACAGTGGG - Intronic
915545900 1:156597629-156597651 TTTGCTGAAGAGCCCACAGCTGG - Intronic
915897289 1:159822086-159822108 ACTGCTGAACAGGCTACAGTTGG + Intergenic
923276750 1:232403308-232403330 AGTCCTGAAGAATCCAGAGAAGG - Intronic
923532779 1:234824847-234824869 AGTCCCGCAGAATCCACAGTGGG - Intergenic
923748642 1:236726389-236726411 AGGGCTGAAGAGTCGCTAGTGGG - Intronic
923786210 1:237071562-237071584 CGTGCTGATGGGTCCACGGTCGG + Intronic
1063589834 10:7385358-7385380 AGAGCTGAGCATTCCACAGTGGG - Intronic
1065065058 10:21953863-21953885 AGTGGTGAAGAATACATAGTTGG - Intronic
1067971160 10:50972565-50972587 GGTGCTGGAAAGTCCACAATAGG - Intergenic
1070722791 10:78768275-78768297 AGAGCTGAAGGGACCACACTGGG - Intergenic
1071547264 10:86538201-86538223 AGTGCTGGTGTGTCCAGAGTTGG + Intergenic
1071873085 10:89816302-89816324 AGTGATGCAGAAGCCACAGTGGG - Intergenic
1077082342 11:729622-729644 AGTGTGGGAGAGTCCACACTGGG + Intergenic
1083015675 11:59451152-59451174 AATGTTGAAAAGTCCACTGTTGG - Intergenic
1084458458 11:69282849-69282871 AGTGCTTAAGGGAGCACAGTGGG + Intergenic
1087165597 11:94999276-94999298 AGTGCAGCAGCTTCCACAGTTGG - Exonic
1089096695 11:115925499-115925521 ACTGCTGCAGGGACCACAGTGGG + Intergenic
1095624225 12:44296165-44296187 TGTGCTTTAGATTCCACAGTTGG + Intronic
1099298773 12:80865594-80865616 AGTGCTGAAATGTCCACTTTGGG + Intronic
1105293906 13:19071881-19071903 TGTGCTGGAGCGTGCACAGTTGG - Intergenic
1105901873 13:24762404-24762426 ATTGATGAAGAGTGAACAGTAGG + Intergenic
1106751548 13:32775157-32775179 ACTGCTGAAGAGTGGACAGTTGG + Exonic
1107129467 13:36879683-36879705 AGTGCATAAGAGGCCACAGCAGG + Exonic
1108532059 13:51336811-51336833 TGTGCTGGAGAGAGCACAGTGGG - Intronic
1110328464 13:74244131-74244153 ATTACTGAAGAGTCAACTGTGGG - Intergenic
1113460282 13:110477949-110477971 TGTGATGAACAGTCCAGAGTTGG + Intronic
1118823139 14:69358107-69358129 AGTGGTGGAGAGTCCCCAGCTGG + Intergenic
1119741081 14:77014124-77014146 AGAGCTGGAGAGTCCAAAGGAGG - Intergenic
1119907867 14:78321977-78321999 AGTGGTGAACAGTCCAAAGTAGG - Intronic
1121280180 14:92692310-92692332 AGTGCTGAGGAGTCCACAGCTGG + Intergenic
1121858472 14:97292991-97293013 ACTTTTGAAGAGTCTACAGTGGG - Intergenic
1122986315 14:105213230-105213252 ACTTCTGGAGAGACCACAGTGGG - Intronic
1124882905 15:33658873-33658895 AATGCTGAAGAGTGCAAAGGGGG + Intronic
1125465816 15:39951354-39951376 CGTGCTTAAGAATCCACTGTGGG - Intronic
1127662826 15:61116044-61116066 AGTGCTGAAGGATCAACAGTGGG - Intronic
1127983483 15:64050875-64050897 AGAACAGAAAAGTCCACAGTGGG + Intronic
1133616105 16:7478457-7478479 AGTGCTTTAGTGTTCACAGTAGG + Intronic
1134477184 16:14585040-14585062 ACTGCAGGAGAGTCCACACTTGG + Intronic
1135956511 16:26960628-26960650 ATTGATGAAGACTACACAGTTGG - Intergenic
1137305926 16:47199913-47199935 AGTGCTGCACAGTTCACAATAGG + Intronic
1139397165 16:66649597-66649619 TGTCCTGCAGACTCCACAGTGGG + Intronic
1139457580 16:67094272-67094294 TGTGATGAAGAGTCAAGAGTAGG - Intronic
1140043171 16:71422921-71422943 GGTCCAGAAGATTCCACAGTGGG - Intergenic
1141193514 16:81842296-81842318 AGTGCAACAGAGTCCACACTGGG - Intronic
1143544146 17:7586673-7586695 AGAGCTGCAGAGTCAAGAGTTGG - Exonic
1145770549 17:27489789-27489811 GGTCATGAAGAATCCACAGTAGG + Intronic
1146247711 17:31304630-31304652 AGTGCTGATGGTTCAACAGTTGG - Exonic
1147572710 17:41581199-41581221 AGTGGTGAAGATTCCAGAGGTGG - Intergenic
1148254859 17:46121353-46121375 AGTGGTGAAGAGGACACAGGAGG - Intronic
1149699294 17:58641914-58641936 ACTGCTGAAGGAACCACAGTTGG + Intronic
1150620513 17:66804368-66804390 AATGCTGAAAAATCCACAGATGG - Exonic
1153375880 18:4378593-4378615 AGTGCTTAAGAATCCATGGTGGG + Intronic
1156089212 18:33444411-33444433 AGAGCATAAGGGTCCACAGTAGG + Intergenic
1159493942 18:69176132-69176154 AGTGGAGAAGGGTCCACAATTGG - Intergenic
1161332191 19:3693626-3693648 AGGGCTGGAGAGTCCACACAGGG - Intronic
1164676407 19:30104520-30104542 AGTGCTGAGAAGTCCACACAAGG + Intergenic
1164918502 19:32071174-32071196 AGTACTGAAGAGTCAATAGAAGG + Intergenic
925679802 2:6408686-6408708 AGTCCTGGAGATTCCACAGAAGG - Intergenic
926009381 2:9396196-9396218 AGTCCTGAAGTGTCCTCAGAAGG - Intronic
926752559 2:16209821-16209843 AGTTGTGAAGTGGCCACAGTAGG + Intergenic
927323034 2:21770516-21770538 ATTGCTGTAGTGTCCATAGTGGG - Intergenic
928303904 2:30149813-30149835 AGTGTTGGACAGACCACAGTGGG - Intronic
928902544 2:36335927-36335949 TGTGATGAATATTCCACAGTAGG + Intergenic
929581024 2:43081987-43082009 AGTACTCAGGAGTCCAGAGTTGG + Intergenic
929862621 2:45692686-45692708 TGTGCTGAAGAGTCCAAGGGAGG + Intronic
934774712 2:96929743-96929765 AGTGCTGCAGAGGCTGCAGTGGG - Intronic
939791900 2:146588057-146588079 AGGGCAAAAGAGTCCAAAGTTGG + Intergenic
939925179 2:148164053-148164075 AGTGCTGATTAGCACACAGTAGG - Intronic
940173920 2:150858142-150858164 AAGGCTGAAGAGTTCACTGTAGG - Intergenic
940810749 2:158240065-158240087 AGAGCTGAAGTGTCCCCACTTGG - Intronic
941615384 2:167712719-167712741 AGTGCAGTAGAATCCACAGTAGG - Intergenic
941718939 2:168792975-168792997 AGTGTTGAAAAGTCAAAAGTTGG - Intronic
946929387 2:224657061-224657083 AGTGCTGGTGTGTCCACAATTGG - Intergenic
947872032 2:233444614-233444636 AGTGCTGAAGGGTGCCCAGAGGG - Intronic
948112936 2:235471554-235471576 AGTGCTGGACAGTTCCCAGTGGG + Intergenic
1170362167 20:15558274-15558296 GGTCCTGAAGAGAGCACAGTAGG - Intronic
1171998725 20:31754525-31754547 AGTGCTGCAGTGCCCAGAGTTGG + Intronic
1173826335 20:46050145-46050167 AGGGATCAAGAGTCCACAGCTGG - Intronic
1175418878 20:58818888-58818910 ATTTCTAAAGAATCCACAGTAGG + Intergenic
1175700074 20:61130572-61130594 GGGGCTGAAGAATCCACTGTGGG - Intergenic
1176181805 20:63752979-63753001 AGTGCTGACCAGCCCCCAGTGGG - Intronic
1179547397 21:42122035-42122057 ATTGCTGAGGACTTCACAGTTGG - Intronic
1180065028 21:45408007-45408029 AATCCTGAAGACTCCCCAGTGGG - Intronic
1180136925 21:45867989-45868011 GGTGCTGAAGAGGCCACAGGAGG + Intronic
1180144442 21:45911320-45911342 AGTGCAGAAGACCCCTCAGTGGG - Intronic
1180692453 22:17728446-17728468 AGGGCTGAAGAGACCTCAGAAGG - Exonic
1181488539 22:23246996-23247018 AAGGGTGCAGAGTCCACAGTCGG - Intronic
1183156708 22:36081360-36081382 AGTGCTGAAGAGGCCTAAGAGGG - Intergenic
1184931322 22:47683258-47683280 AGTGCTCAGGGGTGCACAGTTGG + Intergenic
950552858 3:13677173-13677195 GGTGCTGAAGAGGCCACATGAGG - Intergenic
953130472 3:40133067-40133089 AGTGCTGAGGAGAACACAGAAGG + Intronic
953444252 3:42949243-42949265 AGTGAGAAAGAGTCCACAGATGG + Intronic
955510539 3:59676335-59676357 AGTGCTGGTCAGGCCACAGTGGG + Intergenic
960429606 3:117552623-117552645 AGTGCTCAATAGGCCACAGGTGG - Intergenic
961077439 3:123995111-123995133 AGTGGTGCAGAGTAAACAGTTGG - Intergenic
961307144 3:125966206-125966228 AGTGGTGCAGAGTAAACAGTTGG + Intergenic
962853190 3:139323236-139323258 GGTGCTGCAGAGGCCACAGGGGG - Intronic
964508057 3:157421262-157421284 AGGGCTGGAGGGTCAACAGTTGG - Intronic
966400001 3:179538254-179538276 AGTGCTGAAGGGTGCAAACTAGG + Intergenic
966567120 3:181396083-181396105 ACTGCTTTAGAGTCCACAGTTGG + Intergenic
969082240 4:4627756-4627778 AGTGCTGAGCAGTCCAGAGATGG + Intergenic
969619244 4:8270619-8270641 AGTTCTGAAGAGACCAGAGCTGG - Intronic
975334760 4:73162968-73162990 GGTGCTTAAGAGGCCAAAGTGGG - Intronic
978275889 4:106949166-106949188 ATTGCAGGAGAGTCAACAGTAGG + Intronic
979220342 4:118216072-118216094 TGTGCTGAAGAGTCCATATGTGG + Intronic
980699869 4:136411457-136411479 AGTGCCTAAGAGTACACAATGGG + Intergenic
982494919 4:156078253-156078275 AGTTCTGGGGAGTCCACAATGGG - Intergenic
984517300 4:180756786-180756808 AGTGGTGCATAGTCCATAGTTGG + Intergenic
985014198 4:185616111-185616133 AATGCAGAAGATTCCAGAGTGGG - Intronic
985061699 4:186086453-186086475 GGTTCTGAAGAGTCTATAGTCGG + Exonic
985548571 5:521998-522020 GGGGCTGCAGAGTGCACAGTGGG + Intronic
985977588 5:3433167-3433189 AGTACTGGAGAATCTACAGTTGG + Intergenic
986445246 5:7815701-7815723 AGTCCTGAAGATTTCCCAGTGGG - Intronic
986751181 5:10789307-10789329 AAAGCTGATGAGCCCACAGTTGG + Intergenic
987115740 5:14725315-14725337 AGTGTGGACCAGTCCACAGTTGG - Intronic
990097113 5:52130343-52130365 AGTGCTTAAGATTCCAGAATCGG - Intergenic
990513187 5:56507744-56507766 AGTTCTGGAGAGTCCACAGGGGG + Intergenic
991630093 5:68647980-68648002 AGTCCTAAAGAGACCACACTGGG + Intergenic
996522918 5:124447480-124447502 AGTCCTGAAGAGTCCACTAAGGG - Intergenic
997254810 5:132420310-132420332 AGTGCAGAATAGTCCACCCTGGG - Intronic
997524596 5:134544229-134544251 AGTGCTTAAGAGTACCTAGTGGG + Intronic
998965837 5:147539475-147539497 ACTGCAGAACAGACCACAGTGGG + Intergenic
999722304 5:154407806-154407828 AGTGCTGAAGAGTCCACAGTGGG - Intronic
1001323767 5:170704550-170704572 GGCGCTGAAGAGTCCACGCTAGG - Intronic
1002177402 5:177409045-177409067 AAAGCTGAAGAGCACACAGTCGG - Exonic
1005989765 6:30895604-30895626 AGAGCAGAATAGGCCACAGTGGG - Intronic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1007512478 6:42384556-42384578 AGTTATGAAGAGTCTAAAGTGGG - Intronic
1009355820 6:62742096-62742118 TCTGCTGAAAAGTCCACTGTGGG - Intergenic
1011429129 6:87266524-87266546 ACTGCTGAAGAGTAGACAGACGG - Intergenic
1011510040 6:88090071-88090093 AGTGCAGAAAACTCCACACTTGG + Intergenic
1011863012 6:91784606-91784628 ACTGATGAAGAGACCAGAGTTGG - Intergenic
1011878256 6:91990019-91990041 AGTGCTGAACACTGAACAGTAGG - Intergenic
1014448255 6:121553987-121554009 AGTCCTGAAGAGGCCAAAGCAGG - Intergenic
1017529010 6:155269049-155269071 AGTCCTGCAAAGTCCACTGTGGG - Intronic
1017597761 6:156047406-156047428 AGAGCTGAAGAGATAACAGTTGG + Intergenic
1019033076 6:169030388-169030410 AGTGCTCATGAATCCACAGCTGG - Intergenic
1019184603 6:170213791-170213813 AGCACTGAAGACTCCACACTGGG + Intergenic
1019690269 7:2406539-2406561 AGTGCTGAACAGGGCACAGGAGG + Intronic
1019756104 7:2771426-2771448 AGGGCTGATAAGGCCACAGTGGG - Intronic
1019825325 7:3279617-3279639 AGTGCTTAAGTGTTAACAGTTGG - Intergenic
1020022980 7:4880067-4880089 CGTGGTGAAGTGTCCGCAGTGGG - Intronic
1021694356 7:23261881-23261903 AGTCCTTAAGAGTCCACTTTGGG + Intronic
1023743781 7:43303362-43303384 AGGGCTGCAGAGTCAAAAGTGGG + Intronic
1024548073 7:50538936-50538958 AGGGCTGAAGAGCCCACAGATGG - Intronic
1024709743 7:52002210-52002232 AGTGGAGAAGAGCCCAGAGTAGG + Intergenic
1027566335 7:79799627-79799649 AGTGGAGAAGAGTTCCCAGTAGG - Intergenic
1028461670 7:91100884-91100906 AGTGTTGAAGAGCCCTCAGCAGG - Intronic
1028823795 7:95245478-95245500 AGTTCAGAAGAGCCTACAGTTGG + Intronic
1029129616 7:98319966-98319988 GCTGCTGATGAGTCAACAGTGGG + Intronic
1029705531 7:102273879-102273901 CATTCTGTAGAGTCCACAGTGGG + Intronic
1032736155 7:134694424-134694446 AGTGCTGTAGAATCAACACTAGG + Intergenic
1035322816 7:158044664-158044686 CGTGCTGAAGAGACCACAGCTGG + Intronic
1037542162 8:19882501-19882523 ACTGCTGAAGATTTCACATTTGG - Intergenic
1037658109 8:20904633-20904655 AGTGTTGAGGAATGCACAGTGGG - Intergenic
1038329984 8:26600731-26600753 AGGGCTCAAGGGTCCTCAGTGGG - Intronic
1039372547 8:37001389-37001411 AGTCCTGGAGAGTCTACAGGAGG + Intergenic
1045583799 8:103507838-103507860 AGTGATAAAGAGTACACAGAAGG + Intronic
1051856881 9:21577638-21577660 GGGGCTGGTGAGTCCACAGTAGG + Intergenic
1052116224 9:24651411-24651433 GGTGCTGCAGAATCTACAGTGGG + Intergenic
1052741414 9:32396301-32396323 AGTGATAAAGTGGCCACAGTAGG - Intronic
1055079300 9:72252669-72252691 GGTGCTGATGATTCCCCAGTTGG + Intronic
1057366182 9:94423451-94423473 AGGGCTGAAGAGACCTCAGAAGG - Intronic
1057657150 9:96964612-96964634 AGGGCTGAAGAGACCTCAGAAGG + Intronic
1061534588 9:131239687-131239709 AGTGGTGAAGAGTGCAGACTGGG + Intergenic
1188451044 X:30308604-30308626 GGCGCTCAAGAGTCCACAGGTGG - Exonic
1190767059 X:53484095-53484117 CGTGCAGAAGAGTCTACAGATGG + Intergenic
1193061284 X:77210510-77210532 TGTGCTGAAGTCTCCAAAGTAGG + Intergenic
1194614721 X:96086896-96086918 TGTACGGAAGAGTCCACATTGGG - Intergenic
1195331964 X:103809980-103810002 GGTGCTGTAGGGTGCACAGTAGG + Intergenic
1200290155 X:154863940-154863962 GCTGCTTCAGAGTCCACAGTTGG - Intronic
1200767519 Y:7092895-7092917 AGAACTGAAGAAGCCACAGTTGG + Intergenic
1200950136 Y:8890518-8890540 TGTGCTTGTGAGTCCACAGTGGG + Intergenic
1202163471 Y:21960468-21960490 TGTGCTTGTGAGTCCACAGTGGG - Intergenic
1202227885 Y:22625900-22625922 TGTGCTTGTGAGTCCACAGTGGG + Intergenic
1202315272 Y:23570276-23570298 TGTGCTTGTGAGTCCACAGTGGG - Intergenic
1202555529 Y:26100317-26100339 TGTGCTTGTGAGTCCACAGTGGG + Intergenic