ID: 999726474

View in Genome Browser
Species Human (GRCh38)
Location 5:154442458-154442480
Sequence GTCCACCTGTTCCCAAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999726471_999726474 -2 Left 999726471 5:154442437-154442459 CCAGTCACTGGACACCTAAGTGT No data
Right 999726474 5:154442458-154442480 GTCCACCTGTTCCCAAAGAAGGG No data
999726468_999726474 17 Left 999726468 5:154442418-154442440 CCACTCAAGGATTAGAAACCCAG No data
Right 999726474 5:154442458-154442480 GTCCACCTGTTCCCAAAGAAGGG No data
999726470_999726474 -1 Left 999726470 5:154442436-154442458 CCCAGTCACTGGACACCTAAGTG No data
Right 999726474 5:154442458-154442480 GTCCACCTGTTCCCAAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999726474 Original CRISPR GTCCACCTGTTCCCAAAGAA GGG Intergenic
No off target data available for this crispr