ID: 999730445

View in Genome Browser
Species Human (GRCh38)
Location 5:154473345-154473367
Sequence ATGGAGAAACAGACTCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999730445_999730455 29 Left 999730445 5:154473345-154473367 CCTCCCTGAGTCTGTTTCTCCAT No data
Right 999730455 5:154473397-154473419 GAAAGAAACGGAAAGAAAGAAGG No data
999730445_999730450 -1 Left 999730445 5:154473345-154473367 CCTCCCTGAGTCTGTTTCTCCAT No data
Right 999730450 5:154473367-154473389 TGCGCGCCGGAATTTCTAAACGG No data
999730445_999730452 17 Left 999730445 5:154473345-154473367 CCTCCCTGAGTCTGTTTCTCCAT No data
Right 999730452 5:154473385-154473407 AACGGACTCCCAGAAAGAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999730445 Original CRISPR ATGGAGAAACAGACTCAGGG AGG (reversed) Intergenic
No off target data available for this crispr