ID: 999730501

View in Genome Browser
Species Human (GRCh38)
Location 5:154473658-154473680
Sequence TGGGCGCTAGGAAACAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999730501_999730512 24 Left 999730501 5:154473658-154473680 CCCCCACTGTTTCCTAGCGCCCA No data
Right 999730512 5:154473705-154473727 CGCGTCCGGAAAGGCCCGCGTGG No data
999730501_999730509 10 Left 999730501 5:154473658-154473680 CCCCCACTGTTTCCTAGCGCCCA No data
Right 999730509 5:154473691-154473713 TTTATTAACTCCTTCGCGTCCGG No data
999730501_999730510 15 Left 999730501 5:154473658-154473680 CCCCCACTGTTTCCTAGCGCCCA No data
Right 999730510 5:154473696-154473718 TAACTCCTTCGCGTCCGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999730501 Original CRISPR TGGGCGCTAGGAAACAGTGG GGG (reversed) Intergenic
No off target data available for this crispr