ID: 999730827

View in Genome Browser
Species Human (GRCh38)
Location 5:154475827-154475849
Sequence CCGGCTGGCCGCAGCAAGTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 138}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999730827_999730836 13 Left 999730827 5:154475827-154475849 CCAGACTTGCTGCGGCCAGCCGG 0: 1
1: 0
2: 1
3: 7
4: 138
Right 999730836 5:154475863-154475885 CCTCTTCTCGACTGGGCCCAGGG 0: 1
1: 0
2: 1
3: 9
4: 132
999730827_999730833 6 Left 999730827 5:154475827-154475849 CCAGACTTGCTGCGGCCAGCCGG 0: 1
1: 0
2: 1
3: 7
4: 138
Right 999730833 5:154475856-154475878 CTTTAATCCTCTTCTCGACTGGG 0: 1
1: 0
2: 0
3: 12
4: 103
999730827_999730832 5 Left 999730827 5:154475827-154475849 CCAGACTTGCTGCGGCCAGCCGG 0: 1
1: 0
2: 1
3: 7
4: 138
Right 999730832 5:154475855-154475877 CCTTTAATCCTCTTCTCGACTGG 0: 1
1: 0
2: 0
3: 9
4: 71
999730827_999730837 17 Left 999730827 5:154475827-154475849 CCAGACTTGCTGCGGCCAGCCGG 0: 1
1: 0
2: 1
3: 7
4: 138
Right 999730837 5:154475867-154475889 TTCTCGACTGGGCCCAGGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 143
999730827_999730834 12 Left 999730827 5:154475827-154475849 CCAGACTTGCTGCGGCCAGCCGG 0: 1
1: 0
2: 1
3: 7
4: 138
Right 999730834 5:154475862-154475884 TCCTCTTCTCGACTGGGCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 145
999730827_999730838 20 Left 999730827 5:154475827-154475849 CCAGACTTGCTGCGGCCAGCCGG 0: 1
1: 0
2: 1
3: 7
4: 138
Right 999730838 5:154475870-154475892 TCGACTGGGCCCAGGGCAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999730827 Original CRISPR CCGGCTGGCCGCAGCAAGTC TGG (reversed) Exonic