ID: 999730827

View in Genome Browser
Species Human (GRCh38)
Location 5:154475827-154475849
Sequence CCGGCTGGCCGCAGCAAGTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 138}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999730827_999730836 13 Left 999730827 5:154475827-154475849 CCAGACTTGCTGCGGCCAGCCGG 0: 1
1: 0
2: 1
3: 7
4: 138
Right 999730836 5:154475863-154475885 CCTCTTCTCGACTGGGCCCAGGG 0: 1
1: 0
2: 1
3: 9
4: 132
999730827_999730832 5 Left 999730827 5:154475827-154475849 CCAGACTTGCTGCGGCCAGCCGG 0: 1
1: 0
2: 1
3: 7
4: 138
Right 999730832 5:154475855-154475877 CCTTTAATCCTCTTCTCGACTGG 0: 1
1: 0
2: 0
3: 9
4: 71
999730827_999730838 20 Left 999730827 5:154475827-154475849 CCAGACTTGCTGCGGCCAGCCGG 0: 1
1: 0
2: 1
3: 7
4: 138
Right 999730838 5:154475870-154475892 TCGACTGGGCCCAGGGCAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 279
999730827_999730834 12 Left 999730827 5:154475827-154475849 CCAGACTTGCTGCGGCCAGCCGG 0: 1
1: 0
2: 1
3: 7
4: 138
Right 999730834 5:154475862-154475884 TCCTCTTCTCGACTGGGCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 145
999730827_999730837 17 Left 999730827 5:154475827-154475849 CCAGACTTGCTGCGGCCAGCCGG 0: 1
1: 0
2: 1
3: 7
4: 138
Right 999730837 5:154475867-154475889 TTCTCGACTGGGCCCAGGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 143
999730827_999730833 6 Left 999730827 5:154475827-154475849 CCAGACTTGCTGCGGCCAGCCGG 0: 1
1: 0
2: 1
3: 7
4: 138
Right 999730833 5:154475856-154475878 CTTTAATCCTCTTCTCGACTGGG 0: 1
1: 0
2: 0
3: 12
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999730827 Original CRISPR CCGGCTGGCCGCAGCAAGTC TGG (reversed) Exonic
902822055 1:18949402-18949424 CCGCCTGACAGCAGAAAGTCAGG + Intronic
906961652 1:50422779-50422801 CCAGCAGGCCGCACCAAGCCAGG + Intronic
907759512 1:57343684-57343706 CCGGCCGGCCGCTCCAAGTGTGG + Intronic
908114274 1:60925606-60925628 CCGGCCAGGCGCAGCAGGTCTGG - Intronic
908888576 1:68817803-68817825 CCGGCCGGCCGCTCCAAGTGCGG - Intergenic
909608736 1:77531971-77531993 CCGGATGGCCGCAGGCAGTGAGG - Intronic
915333218 1:155126323-155126345 CCCGGACGCCGCAGCAAGTCTGG - Intergenic
915446229 1:155976421-155976443 CTGGCTGGCAGCAGGGAGTCGGG - Intronic
916939022 1:169661299-169661321 CCGGCTGGCCGCTCCAAGTGTGG - Intergenic
920878475 1:209858928-209858950 CCAGCCGGCCGCTGCAAGTGCGG + Intergenic
923161378 1:231317543-231317565 CCGGCTGGCCGCGCCCAGTGCGG - Intergenic
1063208002 10:3853313-3853335 CCAGGAGGTCGCAGCAAGTCAGG - Intergenic
1066293609 10:34035477-34035499 CTGGCTGGCCGCTCCAAGTGCGG - Intergenic
1067074996 10:43173088-43173110 CTGGCTGGCAGCAGCCAGTTAGG + Intronic
1067845321 10:49715339-49715361 CTGCAAGGCCGCAGCAAGTCTGG + Intergenic
1071901001 10:90120053-90120075 CCGGCTGGCCGCTCCGAGTGCGG + Intergenic
1075645175 10:124092347-124092369 TCGGCTCGCCGCACCAAGGCCGG + Intronic
1079803156 11:24896370-24896392 CCGGCTGGCTGCTCCAAGTGTGG - Intronic
1081331372 11:41804574-41804596 TCGGCTGGGCGCAGCAGCTCAGG + Intergenic
1084210442 11:67619119-67619141 CCGGCTGGCTGCGGCGAGTGCGG - Intergenic
1084941733 11:72616762-72616784 CCGGGTGGGGGCAGCAGGTCAGG + Intronic
1089519931 11:119056843-119056865 CCGGCCCGCCCCAGCAAGTGGGG + Intronic
1091767371 12:3130394-3130416 CTTGCTGGCCACAGCAAGGCAGG + Intronic
1094405366 12:30110726-30110748 CCGGCCGGCCGCTCCAAGTGTGG + Intergenic
1096668257 12:53181144-53181166 CTGGCTGGCCGGAGCGAGGCGGG + Intronic
1105927183 13:25018633-25018655 CAGCCCGGCCGCGGCAAGTCAGG - Intergenic
1109124936 13:58505698-58505720 CCGGCTGGCTGCCCCAAGTGTGG + Intergenic
1109563174 13:64077772-64077794 CCGGCCGGCCGCTCCAAGTGCGG + Intergenic
1113758509 13:112831349-112831371 CGGGCAGGGCACAGCAAGTCAGG - Intronic
1115421367 14:33199017-33199039 CCTGCTGGCCGCTCCAAGTGTGG + Intronic
1117727351 14:58687531-58687553 CCGGCCGGCCGCTCCAAGTGTGG + Intergenic
1118228170 14:63922457-63922479 ACGGCTTGCTGAAGCAAGTCAGG - Intronic
1119303687 14:73590712-73590734 CCGGCCGGCCGCTCCAAGTGCGG + Intergenic
1122216546 14:100208436-100208458 CCGGCTGGCCGCTCCGAGTGTGG + Intergenic
1122218166 14:100218080-100218102 CCTGCCGGCTGCATCAAGTCAGG - Intergenic
1122514520 14:102297768-102297790 CCAGCTGGCCGCACCTAGTGCGG - Intronic
1122776025 14:104117267-104117289 CCGGGTGGCTGCAGCAGGGCAGG + Intergenic
1125631586 15:41151765-41151787 CCGGCTGGCCGCTCCGAGTGCGG - Intergenic
1127884966 15:63190301-63190323 ACGGCTGGCCACAGGAGGTCTGG + Intronic
1129196922 15:73973831-73973853 CCGGCCGGCCGCACCGAGTGCGG - Intergenic
1129467753 15:75733383-75733405 CCTCCTGCCCGCAGCAAATCAGG + Intergenic
1129719465 15:77870203-77870225 CCTCCTGCCCGCAGCAAATCAGG - Intergenic
1131472840 15:92711295-92711317 CCGGCCGGCCGCTCCAAGTGCGG + Intronic
1132497648 16:271290-271312 CACGCTGGCCGCAGAAACTCAGG + Exonic
1132523483 16:402030-402052 CCCGCTCACCGCAGCAGGTCCGG - Exonic
1132652492 16:1027950-1027972 CCCGCTGGCCGGAGCAGGCCCGG + Intergenic
1135486948 16:22874050-22874072 CCTGTTGGCCAAAGCAAGTCTGG + Intronic
1135546809 16:23371959-23371981 AGAGCTGGCCCCAGCAAGTCTGG + Intronic
1136511022 16:30738411-30738433 CCGTCTGTCCGCAGCATGTCAGG + Exonic
1138023069 16:53502599-53502621 CCGGCTGTCCCCAGCGAGCCTGG - Intronic
1138536020 16:57660690-57660712 CCTGCTGGCCTCAGGGAGTCTGG - Intronic
1139600286 16:67982359-67982381 CCGGCTGGCCGCTCCGAGTGCGG - Intergenic
1145321711 17:21770948-21770970 CTGGCTGGACGCCGCAAGCCTGG - Intergenic
1145905319 17:28513124-28513146 CAGGCGGGCAGCACCAAGTCTGG - Intronic
1146445347 17:32928258-32928280 CGGGCGGGCCGCGGCGAGTCGGG + Intronic
1146708830 17:35022911-35022933 CTGCCTGGCAGCAGCTAGTCTGG + Intronic
1147509949 17:41059702-41059724 TCGGCTGGCCGCAGGGAGGCCGG + Exonic
1148991234 17:51668854-51668876 CCGGCCGGCCGCTCCAAGTGTGG - Intronic
1151858277 17:76737986-76738008 TCGCCTGGCCGCAGTGAGTCAGG + Exonic
1159039678 18:63312087-63312109 CCAGCTGCCTGCAGCAAGTTTGG + Intronic
1160487284 18:79305104-79305126 CCAGGTGGCCTCTGCAAGTCTGG - Intronic
1161508522 19:4657503-4657525 CCGGCTGGCCGTTGCGGGTCAGG - Intronic
1165075363 19:33277355-33277377 CCGGCTGGCCGCAGTGAGCAAGG + Intergenic
1165484407 19:36086694-36086716 CTTGCTGGCCTCAGCCAGTCGGG + Exonic
1165915537 19:39256771-39256793 CTGGCTGCCCCCTGCAAGTCTGG + Intergenic
929070040 2:38020595-38020617 CCGGCTGGCCGCTCCCAGTGTGG - Intronic
929537609 2:42793156-42793178 CCGGCCGCACGCAGCAGGTCTGG - Intergenic
933442091 2:82326483-82326505 CCGGCTGGCCGCTCCGAGTGAGG + Intergenic
933506313 2:83181126-83181148 CCGGCTGGCTGCTCCAAGTGTGG - Intergenic
934636305 2:95992420-95992442 CAGCCTGGCCGCGGCAAGTCAGG - Intergenic
934797338 2:97113006-97113028 CAGCCTGGCCGCGGCAAGTCAGG + Intergenic
934836067 2:97590433-97590455 CAGCCTGGCCGCGGCAAGTCAGG - Intergenic
944228413 2:197370654-197370676 CCGGCTGGCCGCTCCGAGTGCGG - Intergenic
947659300 2:231854927-231854949 TCGGCTGGCCGCAGAAACCCAGG + Intergenic
1170429048 20:16260249-16260271 CCTGCTGGCCCCAGCATATCAGG + Intergenic
1171972533 20:31573179-31573201 GCGCCTGGCTCCAGCAAGTCTGG + Intronic
1176127614 20:63482935-63482957 CCGGCTGGCCGCCTGGAGTCAGG - Intergenic
1176136913 20:63527341-63527363 CAGGCTGGGCGCAGCAGCTCAGG + Intergenic
1176172338 20:63701637-63701659 AGGGCTGGCAGCAGCAGGTCTGG + Intronic
1176344843 21:5733751-5733773 CCAGCTGGCCGCTCCAAGTGCGG + Intergenic
1176351657 21:5854335-5854357 CCAGCTGGCCGCTCCAAGTGCGG + Intergenic
1176499984 21:7590704-7590726 CCAGCTGGCCGCTCCAAGTGCGG - Intergenic
1176539164 21:8131821-8131843 CCAGCTGGCCGCTCCAAGTGCGG + Intergenic
1176558115 21:8314866-8314888 CCAGCTGGCCGCTCCAAGTGCGG + Intergenic
1176733404 21:10521630-10521652 CCGCCGGGGCGCAGCGAGTCCGG - Exonic
1180755081 22:18155607-18155629 CCGGCTGGCCGCTCCGAGTGCGG - Intronic
1181572352 22:23774427-23774449 CCGGCTGCCTTCAGCAAGGCTGG + Intronic
1183037108 22:35148819-35148841 CTGGCTTGCCCCAGCAGGTCTGG - Intergenic
1183037404 22:35150643-35150665 CTGGCTTGCCCCAGCAGGTCTGG + Intergenic
1184060328 22:42077590-42077612 CCTGCTGGCCGCAGAAGGGCCGG + Exonic
1185120164 22:48961246-48961268 CCGGCTGACGCCAGCAAGACAGG - Intergenic
1185135273 22:49067357-49067379 TCGGCAGGCCGGAGCAAGTTCGG - Intergenic
1203244112 22_KI270733v1_random:48176-48198 CCAGCTGGCCGCTCCAAGTGCGG + Intergenic
950493657 3:13321044-13321066 CACGCTGGCTGCAGCAAGGCAGG + Intronic
950929377 3:16773799-16773821 CCGGCTGGCTGCTCCAAGTGCGG - Intergenic
953125591 3:40088867-40088889 CTGGCTGGAGGCAGGAAGTCAGG + Intronic
953421143 3:42754229-42754251 CAGGCTGGCAGGAGCAAGCCTGG - Intronic
954035340 3:47848237-47848259 CGGGCGGGCCGCTGCCAGTCCGG + Exonic
967121054 3:186383310-186383332 CCCGGTGGCCTCAGCAAGGCTGG - Intergenic
973190329 4:47378331-47378353 CCGGCCGGCCGCTCCAAGTGCGG + Intronic
973764321 4:54149576-54149598 CCGGCCGGCCGCTCCAAGTGCGG + Intronic
976846058 4:89490140-89490162 CCGGCAGGCCGCTCCAAGTGTGG - Intergenic
977416649 4:96742602-96742624 CCAGCTGGCCGCTCCAAGTGTGG - Intergenic
979920443 4:126490093-126490115 CCGGCCGGCCGCTGCGAGTGCGG - Intergenic
983939817 4:173527298-173527320 CGGGCTGGCCGCAGCACGTCTGG - Exonic
986740439 5:10700729-10700751 CCCTCTTGCCGCAGCAAGGCCGG - Intronic
988264152 5:28928187-28928209 CAGCCCGGCCGCGGCAAGTCAGG - Intergenic
992803001 5:80310261-80310283 CTGGCTGGCCGCTCCAAGTGTGG + Intergenic
995678893 5:114695543-114695565 CCGGCTGGCCGCTCCAAGTGCGG - Intergenic
997860389 5:137410443-137410465 CAGGCTGGCTGCAGGAAGCCAGG + Intronic
999730827 5:154475827-154475849 CCGGCTGGCCGCAGCAAGTCTGG - Exonic
1002816772 6:688345-688367 CCAGCTGGCCCCAGCAACTCAGG + Intronic
1004200249 6:13541625-13541647 CCGGCTGGCCGCTCCGAGTGCGG - Intergenic
1005712006 6:28511923-28511945 CCGGCTGGCCGCTCCGAGTGCGG - Intronic
1006932428 6:37696303-37696325 CCGGCTGTCAGCACCAAGGCCGG - Intronic
1012850981 6:104446419-104446441 CCGACTGGCCGCTGCGAGTGCGG - Intergenic
1013853353 6:114541959-114541981 CCGGCTGGCTGCTCCAAGTGAGG + Intergenic
1014141777 6:117951986-117952008 CCGGCTGGCAGCCACAACTCAGG - Intronic
1018117516 6:160601832-160601854 TCTGCTGGCCACAGCAATTCCGG + Intronic
1018118686 6:160613840-160613862 TCTGCTGGCCGCAGCTACTCCGG + Intronic
1018119287 6:160619392-160619414 TCTGCTGGCCGCAGCTACTCCGG + Intronic
1018119890 6:160624938-160624960 TCTGCTGGCCGCAGCTACTCCGG + Intronic
1018120491 6:160630482-160630504 TCTGCTGGCCGCAGCTACTCCGG + Intronic
1018121087 6:160636031-160636053 TCTGCTGGCCGCAGCTACTCCGG + Intronic
1018121689 6:160641574-160641596 TCTGCTGGCCGCAGCTACTCCGG + Intronic
1019086210 6:169480120-169480142 CCGGCTGGCTGCTCCAAGTGTGG - Intronic
1019520489 7:1458683-1458705 CCGGCTGGCAGCAGCACCTGGGG + Intronic
1022892309 7:34714102-34714124 CCAGCTGTCCGCTGGAAGTCTGG + Intronic
1029655682 7:101922851-101922873 TGGGCTGGCCACAGCATGTCAGG + Intronic
1029993548 7:104984312-104984334 CCCGCTGGCCAGAGCGAGTCGGG - Intergenic
1031513326 7:122674105-122674127 CTGGCTGGCCGCTCCAAGTGTGG + Intronic
1033866652 7:145697645-145697667 CCGGCCGGCCGCTCCAAGTGCGG + Intergenic
1035463918 7:159063416-159063438 CCGGCCGGCCGCTCCAAGTGCGG + Intronic
1037417592 8:18667960-18667982 CCGGCCGGCCGCTCCAAGTGTGG + Intronic
1040304231 8:46203715-46203737 CTGGCAGGCCGCAGGAACTCAGG + Intergenic
1040701766 8:50074945-50074967 CCGGCAGGCCGCTCCAAGTGTGG - Intronic
1054076960 9:60546026-60546048 CAGCCCGGCCTCAGCAAGTCAGG + Intergenic
1056735926 9:89209486-89209508 CCAGCTGGCCGCTCCAAGTGCGG - Intergenic
1058956935 9:109957879-109957901 AGGGCTGGCCGCAGTGAGTCCGG + Intronic
1060305390 9:122406431-122406453 CCGGCTGGCCGCTCCGAGTGTGG + Intergenic
1062517125 9:136942333-136942355 CCGGCTTCCAGCAGCAGGTCAGG + Exonic
1203460442 Un_GL000220v1:31263-31285 CCAGCTGGCCGCTCCAAGTGCGG + Intergenic
1186152617 X:6690784-6690806 CCGGCCGGCCGCTCCAAGTGCGG + Intergenic
1187366044 X:18666616-18666638 CGGGCTGGCCACGGCAAGTGTGG + Intronic
1187927182 X:24260958-24260980 CAGGATGCCCGCAGCAAGACAGG - Intergenic
1190227940 X:48560366-48560388 CCACCTGGCCACAGCCAGTCAGG + Exonic
1195259371 X:103117321-103117343 CCGGCTGGCCCCAGACAGTGAGG - Intergenic