ID: 999730837

View in Genome Browser
Species Human (GRCh38)
Location 5:154475867-154475889
Sequence TTCTCGACTGGGCCCAGGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999730830_999730837 -2 Left 999730830 5:154475846-154475868 CCGGTGCGTCCTTTAATCCTCTT 0: 1
1: 0
2: 1
3: 29
4: 192
Right 999730837 5:154475867-154475889 TTCTCGACTGGGCCCAGGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 143
999730829_999730837 2 Left 999730829 5:154475842-154475864 CCAGCCGGTGCGTCCTTTAATCC 0: 1
1: 0
2: 0
3: 2
4: 27
Right 999730837 5:154475867-154475889 TTCTCGACTGGGCCCAGGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 143
999730827_999730837 17 Left 999730827 5:154475827-154475849 CCAGACTTGCTGCGGCCAGCCGG 0: 1
1: 0
2: 1
3: 7
4: 138
Right 999730837 5:154475867-154475889 TTCTCGACTGGGCCCAGGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 143
999730825_999730837 24 Left 999730825 5:154475820-154475842 CCAGCGCCCAGACTTGCTGCGGC 0: 1
1: 0
2: 4
3: 24
4: 500
Right 999730837 5:154475867-154475889 TTCTCGACTGGGCCCAGGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 143
999730826_999730837 18 Left 999730826 5:154475826-154475848 CCCAGACTTGCTGCGGCCAGCCG 0: 1
1: 0
2: 1
3: 5
4: 84
Right 999730837 5:154475867-154475889 TTCTCGACTGGGCCCAGGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999730837 Original CRISPR TTCTCGACTGGGCCCAGGGC AGG Exonic