ID: 999737059

View in Genome Browser
Species Human (GRCh38)
Location 5:154520979-154521001
Sequence GCCTCTTCCCTGATGTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999737059_999737075 24 Left 999737059 5:154520979-154521001 CCTCCTGACATCAGGGAAGAGGC No data
Right 999737075 5:154521026-154521048 AAGTTGTGGGCGGTGGGTGGGGG No data
999737059_999737066 -7 Left 999737059 5:154520979-154521001 CCTCCTGACATCAGGGAAGAGGC No data
Right 999737066 5:154520995-154521017 AAGAGGCTAGAAGGGGTTAGGGG No data
999737059_999737076 29 Left 999737059 5:154520979-154521001 CCTCCTGACATCAGGGAAGAGGC No data
Right 999737076 5:154521031-154521053 GTGGGCGGTGGGTGGGGGAGTGG No data
999737059_999737073 22 Left 999737059 5:154520979-154521001 CCTCCTGACATCAGGGAAGAGGC No data
Right 999737073 5:154521024-154521046 AGAAGTTGTGGGCGGTGGGTGGG No data
999737059_999737070 17 Left 999737059 5:154520979-154521001 CCTCCTGACATCAGGGAAGAGGC No data
Right 999737070 5:154521019-154521041 TTTTTAGAAGTTGTGGGCGGTGG No data
999737059_999737064 -9 Left 999737059 5:154520979-154521001 CCTCCTGACATCAGGGAAGAGGC No data
Right 999737064 5:154520993-154521015 GGAAGAGGCTAGAAGGGGTTAGG No data
999737059_999737072 21 Left 999737059 5:154520979-154521001 CCTCCTGACATCAGGGAAGAGGC No data
Right 999737072 5:154521023-154521045 TAGAAGTTGTGGGCGGTGGGTGG No data
999737059_999737069 14 Left 999737059 5:154520979-154521001 CCTCCTGACATCAGGGAAGAGGC No data
Right 999737069 5:154521016-154521038 GGCTTTTTAGAAGTTGTGGGCGG No data
999737059_999737067 10 Left 999737059 5:154520979-154521001 CCTCCTGACATCAGGGAAGAGGC No data
Right 999737067 5:154521012-154521034 TAGGGGCTTTTTAGAAGTTGTGG No data
999737059_999737065 -8 Left 999737059 5:154520979-154521001 CCTCCTGACATCAGGGAAGAGGC No data
Right 999737065 5:154520994-154521016 GAAGAGGCTAGAAGGGGTTAGGG No data
999737059_999737068 11 Left 999737059 5:154520979-154521001 CCTCCTGACATCAGGGAAGAGGC No data
Right 999737068 5:154521013-154521035 AGGGGCTTTTTAGAAGTTGTGGG No data
999737059_999737074 23 Left 999737059 5:154520979-154521001 CCTCCTGACATCAGGGAAGAGGC No data
Right 999737074 5:154521025-154521047 GAAGTTGTGGGCGGTGGGTGGGG No data
999737059_999737071 18 Left 999737059 5:154520979-154521001 CCTCCTGACATCAGGGAAGAGGC No data
Right 999737071 5:154521020-154521042 TTTTAGAAGTTGTGGGCGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999737059 Original CRISPR GCCTCTTCCCTGATGTCAGG AGG (reversed) Intergenic
No off target data available for this crispr