ID: 999739197

View in Genome Browser
Species Human (GRCh38)
Location 5:154536828-154536850
Sequence TTTAGGTTGTTCTAGTATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999739194_999739197 16 Left 999739194 5:154536789-154536811 CCATTTGTTGAATAAAAACAAAT No data
Right 999739197 5:154536828-154536850 TTTAGGTTGTTCTAGTATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999739197 Original CRISPR TTTAGGTTGTTCTAGTATCT TGG Intergenic
No off target data available for this crispr