ID: 999745330

View in Genome Browser
Species Human (GRCh38)
Location 5:154587535-154587557
Sequence CACCATTGGAGGCCTGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999745318_999745330 30 Left 999745318 5:154587482-154587504 CCCAACACACACACACACACACA 0: 1018
1: 6359
2: 5986
3: 10167
4: 18530
Right 999745330 5:154587535-154587557 CACCATTGGAGGCCTGGTGTTGG No data
999745319_999745330 29 Left 999745319 5:154587483-154587505 CCAACACACACACACACACACAC 0: 2326
1: 3768
2: 6663
3: 11028
4: 18463
Right 999745330 5:154587535-154587557 CACCATTGGAGGCCTGGTGTTGG No data
999745321_999745330 1 Left 999745321 5:154587511-154587533 CCTTTCTGAACATCCCCCAGGTT No data
Right 999745330 5:154587535-154587557 CACCATTGGAGGCCTGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999745330 Original CRISPR CACCATTGGAGGCCTGGTGT TGG Intergenic
No off target data available for this crispr