ID: 999745757

View in Genome Browser
Species Human (GRCh38)
Location 5:154590577-154590599
Sequence CTTGCCCCCAGTGTGGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999745745_999745757 24 Left 999745745 5:154590530-154590552 CCCATGAGGACAGGAGCCCTGTC No data
Right 999745757 5:154590577-154590599 CTTGCCCCCAGTGTGGGGTCTGG No data
999745751_999745757 -1 Left 999745751 5:154590555-154590577 CCTTATTTAGGGTGCTGCATCCC No data
Right 999745757 5:154590577-154590599 CTTGCCCCCAGTGTGGGGTCTGG No data
999745744_999745757 25 Left 999745744 5:154590529-154590551 CCCCATGAGGACAGGAGCCCTGT No data
Right 999745757 5:154590577-154590599 CTTGCCCCCAGTGTGGGGTCTGG No data
999745749_999745757 8 Left 999745749 5:154590546-154590568 CCCTGTCTGCCTTATTTAGGGTG No data
Right 999745757 5:154590577-154590599 CTTGCCCCCAGTGTGGGGTCTGG No data
999745746_999745757 23 Left 999745746 5:154590531-154590553 CCATGAGGACAGGAGCCCTGTCT No data
Right 999745757 5:154590577-154590599 CTTGCCCCCAGTGTGGGGTCTGG No data
999745750_999745757 7 Left 999745750 5:154590547-154590569 CCTGTCTGCCTTATTTAGGGTGC No data
Right 999745757 5:154590577-154590599 CTTGCCCCCAGTGTGGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999745757 Original CRISPR CTTGCCCCCAGTGTGGGGTC TGG Intergenic
No off target data available for this crispr