ID: 999745799

View in Genome Browser
Species Human (GRCh38)
Location 5:154590810-154590832
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999745799_999745804 20 Left 999745799 5:154590810-154590832 CCAGGTGTTTTACTCCTGTTCTC No data
Right 999745804 5:154590853-154590875 TGCTTCACATGCTCCCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999745799 Original CRISPR GAGAACAGGAGTAAAACACC TGG (reversed) Intergenic
No off target data available for this crispr