ID: 999754652

View in Genome Browser
Species Human (GRCh38)
Location 5:154655332-154655354
Sequence GGAGATTTGTAGCCCTACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999754652_999754659 23 Left 999754652 5:154655332-154655354 CCAGTGTAGGGCTACAAATCTCC No data
Right 999754659 5:154655378-154655400 AGGACATCAAGACTGTTTCTAGG No data
999754652_999754660 27 Left 999754652 5:154655332-154655354 CCAGTGTAGGGCTACAAATCTCC No data
Right 999754660 5:154655382-154655404 CATCAAGACTGTTTCTAGGCCGG No data
999754652_999754654 -1 Left 999754652 5:154655332-154655354 CCAGTGTAGGGCTACAAATCTCC No data
Right 999754654 5:154655354-154655376 CTATTTTTAGAACCCCAATGAGG No data
999754652_999754655 3 Left 999754652 5:154655332-154655354 CCAGTGTAGGGCTACAAATCTCC No data
Right 999754655 5:154655358-154655380 TTTTAGAACCCCAATGAGGAAGG No data
999754652_999754661 28 Left 999754652 5:154655332-154655354 CCAGTGTAGGGCTACAAATCTCC No data
Right 999754661 5:154655383-154655405 ATCAAGACTGTTTCTAGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999754652 Original CRISPR GGAGATTTGTAGCCCTACAC TGG (reversed) Intergenic
No off target data available for this crispr