ID: 999754655

View in Genome Browser
Species Human (GRCh38)
Location 5:154655358-154655380
Sequence TTTTAGAACCCCAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999754652_999754655 3 Left 999754652 5:154655332-154655354 CCAGTGTAGGGCTACAAATCTCC No data
Right 999754655 5:154655358-154655380 TTTTAGAACCCCAATGAGGAAGG No data
999754648_999754655 29 Left 999754648 5:154655306-154655328 CCTGCTGGGGGACATTTGGATGG No data
Right 999754655 5:154655358-154655380 TTTTAGAACCCCAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999754655 Original CRISPR TTTTAGAACCCCAATGAGGA AGG Intergenic
No off target data available for this crispr