ID: 999756513

View in Genome Browser
Species Human (GRCh38)
Location 5:154668609-154668631
Sequence CTCTGCTACCACCTTAATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999756513_999756515 -5 Left 999756513 5:154668609-154668631 CCAAAATTAAGGTGGTAGCAGAG No data
Right 999756515 5:154668627-154668649 CAGAGCTTCCCTCCCTCCGGAGG No data
999756513_999756518 4 Left 999756513 5:154668609-154668631 CCAAAATTAAGGTGGTAGCAGAG No data
Right 999756518 5:154668636-154668658 CCTCCCTCCGGAGGCTCTAGAGG No data
999756513_999756514 -8 Left 999756513 5:154668609-154668631 CCAAAATTAAGGTGGTAGCAGAG No data
Right 999756514 5:154668624-154668646 TAGCAGAGCTTCCCTCCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999756513 Original CRISPR CTCTGCTACCACCTTAATTT TGG (reversed) Intergenic
No off target data available for this crispr