ID: 999757987

View in Genome Browser
Species Human (GRCh38)
Location 5:154679529-154679551
Sequence GTAAACACTAGGAACACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999757973_999757987 30 Left 999757973 5:154679476-154679498 CCCTTAACCACCTTGCTCTGCAG No data
Right 999757987 5:154679529-154679551 GTAAACACTAGGAACACTGCAGG No data
999757977_999757987 20 Left 999757977 5:154679486-154679508 CCTTGCTCTGCAGCATCCCAGGA No data
Right 999757987 5:154679529-154679551 GTAAACACTAGGAACACTGCAGG No data
999757974_999757987 29 Left 999757974 5:154679477-154679499 CCTTAACCACCTTGCTCTGCAGC No data
Right 999757987 5:154679529-154679551 GTAAACACTAGGAACACTGCAGG No data
999757975_999757987 23 Left 999757975 5:154679483-154679505 CCACCTTGCTCTGCAGCATCCCA No data
Right 999757987 5:154679529-154679551 GTAAACACTAGGAACACTGCAGG No data
999757983_999757987 3 Left 999757983 5:154679503-154679525 CCAGGAGGAATGGAGCAAAGGGC No data
Right 999757987 5:154679529-154679551 GTAAACACTAGGAACACTGCAGG No data
999757981_999757987 4 Left 999757981 5:154679502-154679524 CCCAGGAGGAATGGAGCAAAGGG No data
Right 999757987 5:154679529-154679551 GTAAACACTAGGAACACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999757987 Original CRISPR GTAAACACTAGGAACACTGC AGG Intergenic
No off target data available for this crispr