ID: 999758004

View in Genome Browser
Species Human (GRCh38)
Location 5:154679663-154679685
Sequence CAGAGAAGACAGACAGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999758004_999758009 9 Left 999758004 5:154679663-154679685 CCACCATCTGTCTGTCTTCTCTG No data
Right 999758009 5:154679695-154679717 TGTTGGACCTCTTGTGTGTGTGG No data
999758004_999758008 -8 Left 999758004 5:154679663-154679685 CCACCATCTGTCTGTCTTCTCTG No data
Right 999758008 5:154679678-154679700 CTTCTCTGTAGTGGGAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999758004 Original CRISPR CAGAGAAGACAGACAGATGG TGG (reversed) Intergenic
No off target data available for this crispr