ID: 999758719

View in Genome Browser
Species Human (GRCh38)
Location 5:154683846-154683868
Sequence GATCAGAGTAGACCTCAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999758717_999758719 -6 Left 999758717 5:154683829-154683851 CCAGAAAATTATCTGGGGATCAG No data
Right 999758719 5:154683846-154683868 GATCAGAGTAGACCTCAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999758719 Original CRISPR GATCAGAGTAGACCTCAAAT GGG Intergenic
No off target data available for this crispr