ID: 999759151

View in Genome Browser
Species Human (GRCh38)
Location 5:154687011-154687033
Sequence AGCACCATGCTGTGACTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999759151_999759166 23 Left 999759151 5:154687011-154687033 CCCCTCAGTCACAGCATGGTGCT No data
Right 999759166 5:154687057-154687079 TGGGTCTGGGGGAAGATGGACGG No data
999759151_999759157 0 Left 999759151 5:154687011-154687033 CCCCTCAGTCACAGCATGGTGCT No data
Right 999759157 5:154687034-154687056 GTGATTTTGCCAAGAGGCAGGGG No data
999759151_999759158 3 Left 999759151 5:154687011-154687033 CCCCTCAGTCACAGCATGGTGCT No data
Right 999759158 5:154687037-154687059 ATTTTGCCAAGAGGCAGGGGTGG No data
999759151_999759162 10 Left 999759151 5:154687011-154687033 CCCCTCAGTCACAGCATGGTGCT No data
Right 999759162 5:154687044-154687066 CAAGAGGCAGGGGTGGGTCTGGG No data
999759151_999759156 -1 Left 999759151 5:154687011-154687033 CCCCTCAGTCACAGCATGGTGCT No data
Right 999759156 5:154687033-154687055 TGTGATTTTGCCAAGAGGCAGGG No data
999759151_999759163 11 Left 999759151 5:154687011-154687033 CCCCTCAGTCACAGCATGGTGCT No data
Right 999759163 5:154687045-154687067 AAGAGGCAGGGGTGGGTCTGGGG No data
999759151_999759161 9 Left 999759151 5:154687011-154687033 CCCCTCAGTCACAGCATGGTGCT No data
Right 999759161 5:154687043-154687065 CCAAGAGGCAGGGGTGGGTCTGG No data
999759151_999759154 -6 Left 999759151 5:154687011-154687033 CCCCTCAGTCACAGCATGGTGCT No data
Right 999759154 5:154687028-154687050 GGTGCTGTGATTTTGCCAAGAGG No data
999759151_999759159 4 Left 999759151 5:154687011-154687033 CCCCTCAGTCACAGCATGGTGCT No data
Right 999759159 5:154687038-154687060 TTTTGCCAAGAGGCAGGGGTGGG No data
999759151_999759165 19 Left 999759151 5:154687011-154687033 CCCCTCAGTCACAGCATGGTGCT No data
Right 999759165 5:154687053-154687075 GGGGTGGGTCTGGGGGAAGATGG No data
999759151_999759155 -2 Left 999759151 5:154687011-154687033 CCCCTCAGTCACAGCATGGTGCT No data
Right 999759155 5:154687032-154687054 CTGTGATTTTGCCAAGAGGCAGG No data
999759151_999759164 12 Left 999759151 5:154687011-154687033 CCCCTCAGTCACAGCATGGTGCT No data
Right 999759164 5:154687046-154687068 AGAGGCAGGGGTGGGTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999759151 Original CRISPR AGCACCATGCTGTGACTGAG GGG (reversed) Intergenic
No off target data available for this crispr