ID: 999759239

View in Genome Browser
Species Human (GRCh38)
Location 5:154687724-154687746
Sequence CTTTGGAAGGCGAAGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999759226_999759239 27 Left 999759226 5:154687674-154687696 CCCGGCCTGTATTTATATATAAG No data
Right 999759239 5:154687724-154687746 CTTTGGAAGGCGAAGGTGGCAGG No data
999759229_999759239 22 Left 999759229 5:154687679-154687701 CCTGTATTTATATATAAGTTGGG No data
Right 999759239 5:154687724-154687746 CTTTGGAAGGCGAAGGTGGCAGG No data
999759227_999759239 26 Left 999759227 5:154687675-154687697 CCGGCCTGTATTTATATATAAGT No data
Right 999759239 5:154687724-154687746 CTTTGGAAGGCGAAGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999759239 Original CRISPR CTTTGGAAGGCGAAGGTGGC AGG Intergenic
No off target data available for this crispr