ID: 999761166

View in Genome Browser
Species Human (GRCh38)
Location 5:154702258-154702280
Sequence CTAAGTATCTTCAAGTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999761160_999761166 4 Left 999761160 5:154702231-154702253 CCCAGCACCTATCACTAGAGTTC No data
Right 999761166 5:154702258-154702280 CTAAGTATCTTCAAGTGGCCAGG No data
999761158_999761166 25 Left 999761158 5:154702210-154702232 CCCAGGAGATGTTTAGTGGAGCC No data
Right 999761166 5:154702258-154702280 CTAAGTATCTTCAAGTGGCCAGG No data
999761157_999761166 26 Left 999761157 5:154702209-154702231 CCCCAGGAGATGTTTAGTGGAGC No data
Right 999761166 5:154702258-154702280 CTAAGTATCTTCAAGTGGCCAGG No data
999761162_999761166 -3 Left 999761162 5:154702238-154702260 CCTATCACTAGAGTTCTGCCCTA No data
Right 999761166 5:154702258-154702280 CTAAGTATCTTCAAGTGGCCAGG No data
999761159_999761166 24 Left 999761159 5:154702211-154702233 CCAGGAGATGTTTAGTGGAGCCC No data
Right 999761166 5:154702258-154702280 CTAAGTATCTTCAAGTGGCCAGG No data
999761161_999761166 3 Left 999761161 5:154702232-154702254 CCAGCACCTATCACTAGAGTTCT No data
Right 999761166 5:154702258-154702280 CTAAGTATCTTCAAGTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999761166 Original CRISPR CTAAGTATCTTCAAGTGGCC AGG Intergenic
No off target data available for this crispr