ID: 999763587

View in Genome Browser
Species Human (GRCh38)
Location 5:154721583-154721605
Sequence GCTTCCCTGCAGTGGCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 295}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999763587_999763594 12 Left 999763587 5:154721583-154721605 CCTGCCAGCCACTGCAGGGAAGC 0: 1
1: 0
2: 1
3: 31
4: 295
Right 999763594 5:154721618-154721640 TGAGTGCTGGGCCAAGAGTCAGG 0: 1
1: 0
2: 2
3: 31
4: 272
999763587_999763591 -1 Left 999763587 5:154721583-154721605 CCTGCCAGCCACTGCAGGGAAGC 0: 1
1: 0
2: 1
3: 31
4: 295
Right 999763591 5:154721605-154721627 CACCTTGTGTGGCTGAGTGCTGG 0: 1
1: 0
2: 1
3: 17
4: 285
999763587_999763595 19 Left 999763587 5:154721583-154721605 CCTGCCAGCCACTGCAGGGAAGC 0: 1
1: 0
2: 1
3: 31
4: 295
Right 999763595 5:154721625-154721647 TGGGCCAAGAGTCAGGAAACTGG 0: 1
1: 1
2: 3
3: 20
4: 295
999763587_999763592 0 Left 999763587 5:154721583-154721605 CCTGCCAGCCACTGCAGGGAAGC 0: 1
1: 0
2: 1
3: 31
4: 295
Right 999763592 5:154721606-154721628 ACCTTGTGTGGCTGAGTGCTGGG 0: 1
1: 0
2: 0
3: 20
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999763587 Original CRISPR GCTTCCCTGCAGTGGCTGGC AGG (reversed) Intronic
900350577 1:2232589-2232611 GCTTCTGTCCAGTGGCTGTCGGG + Intronic
900392855 1:2441235-2441257 GCTTCACAGCAGGGGCTGGCAGG - Intronic
900494527 1:2970496-2970518 CCTTCTCTGCAGTGGCTGGGCGG + Intergenic
900595460 1:3478319-3478341 GCTCCCCTGCAGTGGTGGGGAGG - Intronic
900660119 1:3777966-3777988 CCTCCCCTGCTGGGGCTGGCAGG - Intergenic
901595174 1:10379405-10379427 GCGCCCCTGCTGCGGCTGGCAGG + Intronic
903443874 1:23408348-23408370 CCTTCCCTGGGGTGGCTGACTGG - Intronic
905942191 1:41873092-41873114 GCTTTGCTGAAGGGGCTGGCAGG + Intronic
909477167 1:76094063-76094085 GTTGCCCTGCAGTGACTGTCAGG - Intronic
912391121 1:109303756-109303778 CAGTCCCTGCACTGGCTGGCTGG + Intronic
912456898 1:109804011-109804033 GCTTCCGTGCACTGGCTTCCAGG - Intergenic
913107216 1:115625530-115625552 GCTTCTCTGCAGGCCCTGGCAGG - Intergenic
913300915 1:117367575-117367597 GCTTCCCGGCGCTGCCTGGCAGG - Exonic
913555600 1:119963568-119963590 GCTTACCTGACGTGCCTGGCTGG + Exonic
913615142 1:120551516-120551538 GCTTCCAGTCAGTTGCTGGCAGG - Intergenic
914047458 1:144103773-144103795 GCTTCTCTGGCTTGGCTGGCTGG + Intergenic
914575132 1:148959392-148959414 GCTTCCAGTCAGTTGCTGGCAGG + Intronic
917906246 1:179589198-179589220 GCGTCCCAGGTGTGGCTGGCGGG - Intergenic
918581623 1:186137592-186137614 GCTTCCCACCATTGGCTGGAAGG - Exonic
920679129 1:208059406-208059428 TTCTCCCTGCTGTGGCTGGCAGG + Intronic
921047917 1:211490503-211490525 GCTTCACTGCAGGGGCAGGCTGG + Intronic
922752468 1:228077018-228077040 GCTTCCAGGCAGAGGCTAGCAGG - Intergenic
923048116 1:230370167-230370189 TCTTGACTGCAGTGGCTGGAGGG - Intronic
923222974 1:231913249-231913271 GCTTGCCCCCAGTGGCTGGTGGG + Intronic
924237564 1:242012029-242012051 GCTTTCTGGCAGTGGATGGCGGG - Intergenic
924948183 1:248859609-248859631 GCGCCACTGCAGTGGCTGGGTGG - Intergenic
1062928785 10:1338842-1338864 GCTTCCTTGCATGGGCTGGAGGG + Intronic
1063127457 10:3148287-3148309 GCTTCTCTGCTGTGTCAGGCTGG - Exonic
1064214588 10:13389205-13389227 GTTTCCTTTCAGTGGATGGCTGG + Intergenic
1066439895 10:35428405-35428427 GCTTTCCTGCAGTTCCTGGATGG - Intronic
1067807783 10:49405157-49405179 GCCTCCCTGCAGTGCTGGGCTGG + Intergenic
1069492768 10:68875417-68875439 GCTACCCTGCTGGGTCTGGCAGG + Intronic
1069598232 10:69686579-69686601 GTTTCCCAGCAGTGGCAGGGAGG + Intronic
1069690781 10:70350606-70350628 ACTTCTCAGCAGGGGCTGGCAGG - Intronic
1070330167 10:75410635-75410657 GCTTGCCTCCCCTGGCTGGCGGG + Intergenic
1070784076 10:79153134-79153156 GCTTCCCAGCTGAGGCTGTCAGG - Intronic
1073318737 10:102600887-102600909 GCTGCCCTGAAGTAGCTGGCTGG + Intronic
1074389544 10:113045396-113045418 GCTTCTCTGCAGTGGTTGAGAGG - Intronic
1076052399 10:127346221-127346243 GCTGCCCTGCTGGGGCTTGCGGG - Intronic
1076764561 10:132625813-132625835 GCTTCTCTGCAAGGGCTGGCAGG + Intronic
1077077916 11:709541-709563 CCTCCCCTGCAGTGGCAGCCTGG + Exonic
1077287567 11:1774444-1774466 GCTTCCCTGCCCTGGCTTACTGG + Intergenic
1077539519 11:3139947-3139969 TCTTCCCTGCAGCTCCTGGCAGG + Intronic
1079242351 11:18729625-18729647 GCCCCGCTCCAGTGGCTGGCTGG + Intronic
1080457739 11:32431113-32431135 GCTTCTCTGCAGCCGCCGGCGGG - Intronic
1080756578 11:35206127-35206149 CCTTCCTTGCATTGGATGGCTGG - Exonic
1081117342 11:39220094-39220116 GCTTCACTGAGGTGGCAGGCAGG - Intergenic
1081582885 11:44364752-44364774 GCTTCCAGGCCGTGTCTGGCAGG - Intergenic
1083185940 11:61017997-61018019 GCTTACCTGAAAAGGCTGGCTGG - Exonic
1084429209 11:69101971-69101993 GTGTCCCCACAGTGGCTGGCAGG - Intergenic
1089305795 11:117525295-117525317 GATTCCCAGCAGGGGCTGGGAGG + Intronic
1089453711 11:118613604-118613626 GTATCCATGCTGTGGCTGGCTGG + Intronic
1089554975 11:119311248-119311270 GCATCCCTGCAGGGGATGGCAGG - Intronic
1090858863 11:130635188-130635210 GCTTCCCTGCAGAGTCAGGCAGG + Intergenic
1091549726 12:1528828-1528850 GCTTCCCTCCAGCAGCAGGCAGG + Intergenic
1092055599 12:5505856-5505878 GCTATCCTGCAGTGGCTGATGGG - Intronic
1092353109 12:7772174-7772196 ATTTCCCTGCACTGGCTGCCAGG - Intronic
1093293669 12:17360772-17360794 GCTTTCCTGTACTGGCTGCCTGG + Intergenic
1096103998 12:48986249-48986271 GCTTTCCTGATGAGGCTGGCAGG - Intergenic
1099927901 12:89040332-89040354 GCTTCCGTGCGAGGGCTGGCTGG - Intergenic
1100088216 12:90937053-90937075 GGATCCCTGCAGTGCCAGGCAGG + Intronic
1100304744 12:93339945-93339967 GCATCCCTTCAGTGGGTGTCTGG - Intergenic
1103456579 12:121071654-121071676 TGCTCCCTGCAGTGGCTGGCAGG - Intergenic
1103958560 12:124593323-124593345 TCTGCCCTGCAGTGGTTGCCTGG + Intergenic
1104411124 12:128558702-128558724 TCTTCCTTTCAGTGGCTGGTTGG + Intronic
1104432474 12:128727737-128727759 GCCCCCCTGCAAGGGCTGGCAGG - Intergenic
1104657679 12:130585746-130585768 ACTTCCCTGCAGGGGCAGCCTGG - Intronic
1106383430 13:29262479-29262501 GCTTCTCTGGAGTGTCTGGGTGG + Intronic
1112041278 13:95551146-95551168 GCAGCCGTGCAGCGGCTGGCAGG - Intronic
1113603701 13:111589670-111589692 AATACCCTGCAGAGGCTGGCAGG + Intronic
1113738821 13:112697029-112697051 GCTTGCGCGCAGTGGGTGGCGGG + Intronic
1114055994 14:18967341-18967363 GCTCCCCTGCTGGGGTTGGCAGG + Intergenic
1114106555 14:19434412-19434434 GCTCCCCTGCTGGGGTTGGCAGG - Intergenic
1115712626 14:36067574-36067596 GCTTCACAGCATTGGCTTGCAGG - Intergenic
1118376768 14:65184274-65184296 GCTTCCCTACAGTGGGTAGATGG - Intergenic
1118904018 14:70010466-70010488 GCATCCCTGGAGTCCCTGGCTGG + Intronic
1119380955 14:74227788-74227810 GCTTCACTCCAGAGGCTGGATGG + Intergenic
1119878950 14:78084981-78085003 GCTGCCCTGAACTGGCTTGCTGG + Intergenic
1121329293 14:93040004-93040026 GCCTCCCAGCAGGGGCTGGCAGG - Intronic
1121551813 14:94808542-94808564 GCCTCCCTACTGAGGCTGGCAGG - Intergenic
1121685370 14:95831567-95831589 GCTTCTCTGCAGCTCCTGGCTGG + Intergenic
1122717075 14:103702243-103702265 GCTTCCCTGCAGACACTGGCTGG - Intronic
1123061477 14:105596664-105596686 GTGGCCCTGGAGTGGCTGGCGGG - Intergenic
1202895299 14_GL000194v1_random:3090-3112 GCTGCCCTCCTGTGCCTGGCAGG - Intergenic
1123416698 15:20100611-20100633 GCTTGGCTGGATTGGCTGGCTGG + Intergenic
1123417177 15:20102546-20102568 GCTTCGCTGGCTTGGCTGGCTGG + Intergenic
1123417584 15:20104311-20104333 GCTTGGCTGGATTGGCTGGCCGG + Intergenic
1123417688 15:20104737-20104759 GCTTGGCTGGATTGGCTGGCCGG + Intergenic
1123447229 15:20340265-20340287 GCTTCGCTGGCTTGGCTGGCTGG - Intergenic
1123447371 15:20340886-20340908 GCTTGGCTGCCTTGGCTGGCTGG - Intergenic
1123447388 15:20340955-20340977 GCTTGCCTGGCTTGGCTGGCTGG - Intergenic
1123526037 15:21107717-21107739 GCTTGGCTGGATTGGCTGGCTGG + Intergenic
1123526453 15:21109400-21109422 GCTTCGCTGGCTTGGCTGGCTGG + Intergenic
1123526958 15:21111589-21111611 GCTTGGCTGGATTGGCTGGCCGG + Intergenic
1124642123 15:31402261-31402283 TCTTCCTTTCAGAGGCTGGCGGG - Intronic
1126335514 15:47582770-47582792 GCTGCCCTTGAGAGGCTGGCAGG - Intronic
1127644741 15:60947129-60947151 ACTTCCCAGAAGGGGCTGGCCGG - Intronic
1128242239 15:66108952-66108974 GCTTCCCTTCAGAGGCCGCCCGG + Intronic
1129188360 15:73923877-73923899 GGTCTCCTGCAGTGGCTGACAGG - Intergenic
1129873736 15:78958597-78958619 GCCTCCCTGCTGAGGCTGGAAGG + Intergenic
1130993317 15:88889714-88889736 ACTTCCCTGCAGGGGCTGAGTGG + Intronic
1132506294 16:310958-310980 GCTTCTCTCCAGGAGCTGGCAGG + Intronic
1133495033 16:6309722-6309744 GCTTCCCTACAGAGGGAGGCTGG + Intronic
1135089505 16:19501896-19501918 GCATCCCTGCCGTGGGTTGCTGG - Exonic
1135484874 16:22855432-22855454 GCTTCCAGGCCCTGGCTGGCTGG + Intronic
1136364327 16:29802348-29802370 GCTTCCCTGCTGTGGGCAGCTGG - Intronic
1136822925 16:33336835-33336857 GCTTCACTGGCTTGGCTGGCTGG + Intergenic
1136823607 16:33339788-33339810 GCTTCACTGGCTTGGCTGGCTGG + Intergenic
1136823627 16:33339876-33339898 GCTTGGCTGCCTTGGCTGGCTGG + Intergenic
1136834428 16:33491592-33491614 GCTTGGCTGCCTTGGCTGGCTGG + Intergenic
1137252010 16:46747684-46747706 GCTTCCCTGCCCTGGCTGGATGG - Intronic
1137601236 16:49757777-49757799 GTTTCCCTGCCGTGGCAGGTGGG + Intronic
1137650317 16:50114437-50114459 GGTTCCCTGCAGGTGCTGGAAGG + Intergenic
1138539402 16:57679330-57679352 TCTGCCCTGCAGTGGCTGCCAGG - Intronic
1140800056 16:78478658-78478680 GGTTCACTGCACTGGCTGGCAGG + Intronic
1142380548 16:89729565-89729587 GAGTCCCAGCAGTGGATGGCAGG + Intronic
1203010375 16_KI270728v1_random:232445-232467 GCTTGGCTGCCTTGGCTGGCTGG - Intergenic
1203138929 16_KI270728v1_random:1747482-1747504 GCTTCGCTGGCTTGGCTGGCTGG - Intergenic
1203139075 16_KI270728v1_random:1748129-1748151 GCTTGGCTGCCTTGGCTGGCTGG - Intergenic
1203139097 16_KI270728v1_random:1748215-1748237 GCTTGGCTGCCTTGGCTGGCCGG - Intergenic
1203139137 16_KI270728v1_random:1748387-1748409 GCTTCCCTGGCTTGGCTGGCTGG - Intergenic
1203139142 16_KI270728v1_random:1748413-1748435 GCTTGGCTGCTTTGGCTGGCTGG - Intergenic
1203144516 16_KI270728v1_random:1791555-1791577 GCTTGGCTGCCTTGGCTGGCTGG + Intergenic
1203144648 16_KI270728v1_random:1792155-1792177 GCTTGGCTGCCTTGGCTGGCTGG + Intergenic
1143038771 17:4016940-4016962 GCAGCCCTGCAGGTGCTGGCAGG - Intronic
1145302353 17:21649549-21649571 GAGTACCTGCTGTGGCTGGCAGG + Intergenic
1145347965 17:22053763-22053785 GAGTACCTGCTGTGGCTGGCAGG - Intergenic
1145415619 17:22711619-22711641 GAGTACCTGCTGTGGCTGGCAGG + Intergenic
1148829878 17:50424833-50424855 GGTTCCCAGCCGTGGCTGGCAGG - Intergenic
1152654872 17:81514811-81514833 GCTTCCCGGCGGAGGCGGGCGGG - Intronic
1153551846 18:6270753-6270775 GCTGCACTGCAGGGGCTGGAGGG + Intronic
1153766040 18:8376078-8376100 GTTTCACTTCACTGGCTGGCCGG + Exonic
1155211786 18:23608313-23608335 GCTTCTATGGAGTGGCTGGTAGG + Intronic
1156861364 18:41839997-41840019 TCTTCCCTGCTGAGGCTGTCAGG - Intergenic
1157102738 18:44744807-44744829 GCTTGCTTTCAGTGGCAGGCCGG + Intronic
1157818649 18:50749552-50749574 GCTGCCCTGCATTGGTGGGCGGG - Intergenic
1159928635 18:74291187-74291209 GCATTCCCGCAGTGGCCGGCTGG - Intronic
1160506202 18:79427949-79427971 GCCTCTGTGCAGTGGGTGGCGGG + Intronic
1161043472 19:2122168-2122190 TCTTCCCTGCACTGGCTGGGTGG - Intronic
1161044519 19:2128121-2128143 CCTTCCCTGCAGTGGGGGCCGGG + Intronic
1161587722 19:5114523-5114545 CACTCCCTGCAGGGGCTGGCAGG - Intronic
1163384247 19:16989637-16989659 TCTTACCTGCAGTGGGTGGGAGG + Exonic
1163763718 19:19150850-19150872 TCTTCCTCTCAGTGGCTGGCAGG - Intronic
1164637625 19:29802891-29802913 GAGTGGCTGCAGTGGCTGGCAGG - Intergenic
1164657855 19:29937838-29937860 GCTTTCCTGGAATGGCTGGCTGG - Intronic
1165558860 19:36661027-36661049 GCCTCCCTGCAGTGGCTTACTGG - Intronic
1166099827 19:40565406-40565428 ACGTCCCTGCAGTGGGTGGCAGG - Exonic
1166314267 19:41980028-41980050 GCCCCTCTGCACTGGCTGGCTGG + Intronic
1166586714 19:43955422-43955444 GCTCCCTTGCAGTGGCTGCCTGG - Intronic
1167236163 19:48316953-48316975 GCTGGAGTGCAGTGGCTGGCAGG - Intronic
1167276547 19:48543560-48543582 CCTTCCCTGCAGTGGCTTCAGGG - Intergenic
925150167 2:1610231-1610253 GCTGCACTGCAGGGGCCGGCGGG - Intergenic
925409103 2:3628548-3628570 GCTGCCCTGAACAGGCTGGCTGG + Intronic
925958449 2:8992944-8992966 GCTTCCCTGGACTGGATGGATGG + Intronic
926153211 2:10435889-10435911 GCTGCCCTGCCGTGGGTGGGGGG + Intergenic
926437925 2:12856357-12856379 GATTCAGTGCTGTGGCTGGCCGG + Intergenic
927964572 2:27261340-27261362 GCTTCCCTGGAGGGGCAGGTAGG + Intronic
928095305 2:28401081-28401103 GCTTCCCAGGAGTGGGTAGCTGG + Intronic
928246307 2:29631482-29631504 GCATTCCTGCAGCAGCTGGCAGG + Intronic
928312102 2:30219794-30219816 GCTTCTCTGCAGCAGCTGCCTGG - Intergenic
929501568 2:42494582-42494604 GCTTCCCTCCGCGGGCTGGCAGG - Exonic
929547717 2:42866566-42866588 GCTGCCCTGCAAGGGCTGCCAGG + Intergenic
929789448 2:45012679-45012701 GCTTCCCTGAAGTCCCTGGGAGG + Intergenic
930619941 2:53633210-53633232 TTTTCCCTGCTGTGACTGGCAGG + Intronic
931441991 2:62296550-62296572 GCTTCCCTGCAAGGGCGGGAGGG + Intergenic
931584677 2:63812303-63812325 GGTGCCCAGCAATGGCTGGCTGG - Intronic
933876020 2:86623023-86623045 GCTTCCCCGCCGGGGATGGCCGG - Exonic
933963935 2:87421097-87421119 GCTTGGCTGCCTTGGCTGGCTGG - Intergenic
933965571 2:87428662-87428684 GCTTGTCTGCCTTGGCTGGCTGG - Intergenic
933965593 2:87428765-87428787 GCTTGGCTGCCTTGGCTGGCTGG - Intergenic
934071209 2:88385285-88385307 GCTTCTGTGAAGGGGCTGGCGGG - Intergenic
934243665 2:90291399-90291421 GCTTGGCTGCCTTGGCTGGCTGG - Intergenic
934243954 2:90292667-90292689 GCTTGGCTGGCGTGGCTGGCTGG - Intergenic
934244662 2:90296726-90296748 GCTTCACTGGCTTGGCTGGCTGG - Intergenic
934264185 2:91500716-91500738 GCTTCACTGGCTTGGCTGGCTGG + Intergenic
934746534 2:96763174-96763196 GCTTCCCTCCAGTGGTCTGCTGG + Intronic
935064582 2:99636721-99636743 GGCTCCCGGCTGTGGCTGGCTGG - Intronic
936521138 2:113212821-113212843 GCTTCCCTCCACAGCCTGGCTGG + Intergenic
937885735 2:126898945-126898967 TCTTCCCTTCAATGGCAGGCAGG - Exonic
938094568 2:128453019-128453041 CCTTCTCTGACGTGGCTGGCTGG + Intergenic
938244941 2:129769093-129769115 GCTCACCTGCAGAGGCTGACGGG - Intergenic
938336955 2:130509362-130509384 GCTTACCTGCTGGGGTTGGCAGG - Exonic
938352886 2:130611384-130611406 GCTTACCTGCTGGGGTTGGCAGG + Intergenic
942087203 2:172454612-172454634 GATTTCCTGCTGTGGATGGCAGG + Intronic
942140434 2:172972141-172972163 GCTGTCCTGCAGAGGCTGGGTGG + Intronic
942938070 2:181582577-181582599 GCTGAAGTGCAGTGGCTGGCGGG + Intronic
944894580 2:204151021-204151043 GCCTCCCTGCAATACCTGGCAGG + Intergenic
945154709 2:206826563-206826585 GCTGGAGTGCAGTGGCTGGCTGG + Intergenic
946526875 2:220530224-220530246 GCTTCCCTGCAGCCTCTGGGGGG + Intergenic
948138888 2:235658638-235658660 GCTTCCCTGGAGCTGTTGGCGGG + Intronic
948447817 2:238046650-238046672 TCTTCAGGGCAGTGGCTGGCAGG - Intronic
948514180 2:238493152-238493174 TCTTCCCTGCAGCGTTTGGCTGG + Intergenic
948879157 2:240847344-240847366 GCTGCCCTGCCCTGGCTGCCTGG - Intergenic
1169270452 20:4195357-4195379 GCTTCCCTGCAGACAGTGGCAGG + Intergenic
1171377230 20:24701793-24701815 GCTTGGCTGCTGTGGCAGGCTGG - Intergenic
1171518934 20:25760976-25760998 GAGTACCTGCTGTGGCTGGCAGG + Intergenic
1173054503 20:39597924-39597946 GCTGCCCTGCTGTGGAAGGCAGG - Intergenic
1173698903 20:45048938-45048960 GCTTCCCTTCTGTGCCTGCCTGG + Intronic
1174869966 20:54173373-54173395 GCTGCCCAGCAGTGGCCAGCTGG + Exonic
1176020625 20:62960814-62960836 GCCTTTCTGGAGTGGCTGGCAGG + Intronic
1176231671 20:64036190-64036212 GCTTCCCTGGACAGGCTGCCTGG - Intronic
1176429358 21:6566639-6566661 GCCTCCCTGCAATGGCTGCCAGG - Intergenic
1176614998 21:9019077-9019099 GCTGCCCTCCTGTGCCTGGCAGG - Intergenic
1176653082 21:9567384-9567406 GAATACCTGCTGTGGCTGGCAGG + Intergenic
1177080574 21:16634010-16634032 GCTTCCCTGCAGTGGGAGAGGGG - Intergenic
1178707728 21:34889102-34889124 GCCTGCCTGCAGCGGCTCGCGGG - Intronic
1179245980 21:39634636-39634658 GCATCCCTGCAGGGGCTGCAGGG + Intronic
1179503685 21:41825539-41825561 TCCTCCGTGCAGTGGATGGCTGG - Intronic
1179704750 21:43174101-43174123 GCCTCCCTGCAATGGCTGCCAGG - Intergenic
1180047982 21:45318529-45318551 GGTCACCTGCAGTGGCTGCCAGG + Intergenic
1180098888 21:45575074-45575096 TCTCCCCTGGAGTGCCTGGCTGG + Intergenic
1180154437 21:45971219-45971241 GCTGCCCTGCAGTGACAGGGAGG - Intergenic
1180155963 21:45977573-45977595 GCTGCACTGCAGGGTCTGGCTGG - Intergenic
1180474473 22:15689933-15689955 GCTCCCCTGCTGGGGTTGGCAGG + Intergenic
1180554577 22:16564194-16564216 GCTTGGCTGGTGTGGCTGGCTGG - Intergenic
1180554792 22:16565118-16565140 GCTTCGCTGGCTTGGCTGGCTGG - Intergenic
1180555036 22:16566171-16566193 GCTTGCCTGGTTTGGCTGGCTGG - Intergenic
1180555118 22:16566499-16566521 GCTTGCCTGGTTTGGCTGGCTGG - Intergenic
1180555389 22:16567665-16567687 GCTTGGCTGCCTTGGCTGGCTGG - Intergenic
1180555537 22:16568296-16568318 GCTTGCCTGGTTTGGCTGGCTGG - Intergenic
1181036155 22:20170648-20170670 GCTTCTCTGCTGAGGCTGGATGG - Intergenic
1181049806 22:20233172-20233194 GTGTCCCTGCAGAGACTGGCTGG - Intergenic
1181734357 22:24870186-24870208 GGTTCCATGGAGTGGCTGGGAGG - Intronic
1183371045 22:37432672-37432694 GCTTCCCTCACGTGGCTGGCAGG + Intergenic
1183726010 22:39590091-39590113 GCTGCCCTGCAGGGCCTGCCCGG + Intronic
1184098546 22:42329644-42329666 GCATCCCTGCAGTGGCCTCCTGG - Intronic
1184279329 22:43428098-43428120 GCTTACATCCAGTGGATGGCAGG + Intronic
1184298955 22:43543678-43543700 GCTGCCCTGGAGGGGCTGGATGG + Intronic
1184355655 22:43977860-43977882 CCTTCCCTGCAGGAACTGGCAGG + Exonic
1184597678 22:45524202-45524224 GCTTCCCTGCACTGCCAGCCAGG - Intronic
1184651389 22:45920865-45920887 GGTTCCTTGCAGAGGCTGCCGGG + Exonic
1184655284 22:45938159-45938181 TCATCCCTGCAGTGGCACGCAGG + Intronic
950710950 3:14812289-14812311 CTTTCCAAGCAGTGGCTGGCTGG - Intergenic
953337304 3:42104210-42104232 GCCTCCCTACAGAGGCAGGCAGG - Intronic
953753059 3:45624175-45624197 GCATCCCTGCAGATGCTGACTGG + Intronic
955289244 3:57675634-57675656 GCTTCCTTGCAGGGGCTGTGGGG - Intronic
955419705 3:58724157-58724179 TTTTCCCTGCTGGGGCTGGCTGG + Intronic
955638162 3:61053106-61053128 CCTTCCCTGCAGTGGATGGGAGG - Intronic
956386512 3:68725261-68725283 GCTGGCCAGCAGTGGCAGGCTGG - Intergenic
956742361 3:72285193-72285215 GCTTGAGTGCAGTGTCTGGCAGG + Intergenic
959170844 3:102842083-102842105 GATTCCCTCCCGTGCCTGGCTGG - Intergenic
961054886 3:123779443-123779465 GCTTCCCAGCATTTGGTGGCCGG + Intronic
961340493 3:126213911-126213933 CCTTCCCTTCTGTGCCTGGCTGG - Intergenic
962374849 3:134851093-134851115 GTGTCCCTCCAGTGTCTGGCTGG + Intronic
963286079 3:143435910-143435932 CCCTCCCTGCAGGGGCTGCCTGG + Intronic
963851014 3:150210648-150210670 GCTTCCCTGCAGGGGCCTGTAGG + Intergenic
965469009 3:169066692-169066714 GCTTCCCTCCATTGTCTGTCTGG + Intergenic
966230590 3:177647623-177647645 GCTTCCCCGGAGTTCCTGGCAGG + Intergenic
967404238 3:189098894-189098916 GTCACCCTGCAGTGTCTGGCAGG + Intronic
968733130 4:2281086-2281108 GCCTCCCTGCCCTGGTTGGCTGG + Intronic
969445724 4:7243797-7243819 GCTTCCCTGCGAGGGCAGGCCGG + Intronic
969566487 4:7981841-7981863 ACTGCCCTGCACTAGCTGGCTGG - Intronic
970779689 4:19721586-19721608 CCTTCACTCCAGAGGCTGGCTGG + Intergenic
970951173 4:21757051-21757073 GCTGGAGTGCAGTGGCTGGCTGG - Intronic
973712404 4:53642840-53642862 GCTTCCATGCCATGGCTGGGAGG - Intronic
974877615 4:67717408-67717430 ACCTCCCTGCAATGGGTGGCAGG + Intergenic
975597289 4:76061172-76061194 GCTTCTCTACAGTATCTGGCTGG + Intronic
975644299 4:76530807-76530829 GCCTCCATCCTGTGGCTGGCTGG + Intronic
977827586 4:101551973-101551995 GCTTCAGTGCAGAGTCTGGCCGG + Intronic
978424475 4:108567712-108567734 CCTTCCCTGCAGTCCATGGCTGG - Intergenic
980671110 4:136008515-136008537 GCAGCCCAGCACTGGCTGGCAGG + Intergenic
982455954 4:155609681-155609703 TCTTTCCTGCAGTGATTGGCTGG - Intergenic
982811017 4:159826027-159826049 TCTTCTCTTTAGTGGCTGGCTGG + Intergenic
984497202 4:180513784-180513806 GCTTGGCTGCAATGGCTGGAGGG - Intergenic
985913861 5:2903150-2903172 GATTCCCTGCTGTGGCCAGCAGG - Intergenic
985964469 5:3329531-3329553 GCCACTCTGCAGAGGCTGGCAGG + Intergenic
986233091 5:5884859-5884881 CCATCCCTGCAGGGGCAGGCAGG - Intergenic
986877164 5:12125972-12125994 GATTCCCTCCCGTGTCTGGCTGG + Intergenic
987549888 5:19365791-19365813 GCTTACCTGAGGTGGCTGGAGGG + Intergenic
990321699 5:54636034-54636056 GCTTCCCATCACTGGCTGACTGG + Intergenic
990971579 5:61512616-61512638 CCTTGCCTGCAGTTGCTGTCAGG + Intronic
992000855 5:72434899-72434921 GCTGGCCTGCTGAGGCTGGCAGG - Intergenic
992124625 5:73627125-73627147 GCGTCCCCGCATTGGTTGGCTGG + Intronic
992956156 5:81910664-81910686 ACTTCCCTGCAGAGAGTGGCAGG - Intergenic
993655353 5:90571736-90571758 TGTTCCCTTCAGTGGCTGCCAGG + Intronic
994371842 5:98976519-98976541 GCTTCCATGAAGTGGCTTGAGGG - Intergenic
997595755 5:135106385-135106407 GGTTCCCTCCAGTGGCGTGCTGG - Intronic
997962768 5:138335207-138335229 TCTGCCCTGCAGAGGCTGGCTGG - Intronic
998473348 5:142400538-142400560 CCTTCCCAGCTGTGGCTCGCTGG + Intergenic
999389454 5:151179703-151179725 CATTCCCTGCAGTGGCTGCAAGG + Intergenic
999763587 5:154721583-154721605 GCTTCCCTGCAGTGGCTGGCAGG - Intronic
1000125018 5:158235651-158235673 GCTCCCCTGGAGTGGATGGCAGG + Intergenic
1001209008 5:169792944-169792966 ACTTGCCTGCAGCTGCTGGCTGG - Intronic
1001763376 5:174225456-174225478 GCCTCCCTACAGAGGCAGGCAGG + Intronic
1002890515 6:1327650-1327672 GACTCCCTGCCGTGGCTTGCAGG + Intergenic
1003187894 6:3849146-3849168 CCTGCCCAGCCGTGGCTGGCCGG - Intergenic
1003939547 6:11010477-11010499 GCTTTCCTCCAGTGTCTGTCTGG - Intronic
1006741679 6:36313340-36313362 GCTTCCTTGCTGGGCCTGGCGGG - Intergenic
1012264800 6:97128792-97128814 CCTTCACTGCAGTGCCTGCCAGG - Intronic
1014293300 6:119586684-119586706 GCGGCCCTGCAGCAGCTGGCAGG + Intergenic
1018656845 6:166045049-166045071 GCTTCCCTCCAGTGGGAGGTGGG + Intergenic
1019468247 7:1202305-1202327 GCTTCCGTGCTGTGGACGGCAGG - Intergenic
1021085950 7:16421213-16421235 GCCTCCCTGCAGAGCGTGGCCGG - Exonic
1024222309 7:47298323-47298345 GCTTCCCTGGTGAGGCTGGTAGG + Intronic
1025108027 7:56189157-56189179 GCTGCCTTGCAGAAGCTGGCTGG - Intergenic
1026310218 7:69176905-69176927 GCTGCCTTGCAGAAGCTGGCTGG + Intergenic
1029267798 7:99355915-99355937 ACTTCTCTGCTGTGGCTGGAAGG + Intronic
1031820421 7:126493950-126493972 GCTTCCCTGGCATGACTGGCAGG + Intronic
1032320984 7:130886538-130886560 TCTTCTCTGCAGTGGCAGGCTGG - Intergenic
1034039484 7:147862110-147862132 GCTTCCTTGAAGTGGTTTGCTGG - Intronic
1036412423 8:8514462-8514484 ACTTCCCTACAGTGGCTGAATGG - Intergenic
1036683307 8:10891856-10891878 CTTTCCTTGCACTGGCTGGCAGG - Intergenic
1037040605 8:14227168-14227190 GCTTCCCTGGAGTGGCAGGCTGG + Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1038176278 8:25184514-25184536 GCTTCCCTGGAGCGGCTTCCTGG - Intergenic
1039613760 8:38938709-38938731 GCTACCCAGCAGTGGTTGACTGG - Intronic
1039800835 8:40953120-40953142 TTTTCCCTGAAGTGGCTGGCAGG + Intergenic
1040800174 8:51331356-51331378 GGATCCCTGCAGTGTCAGGCAGG - Intronic
1042325979 8:67528328-67528350 GCTTCCATGCAGAGGCTGGTTGG + Intronic
1046293635 8:112194504-112194526 TCTTCCCTGCAGCCCCTGGCAGG + Intergenic
1047405085 8:124578501-124578523 TCATCCCAGCACTGGCTGGCAGG + Intronic
1049091169 8:140514773-140514795 TTTTCCCTTCAGTGGCAGGCAGG - Intronic
1049353257 8:142175453-142175475 GCATCCCTGCAGGTGCTGGGTGG - Intergenic
1049472710 8:142783482-142783504 GCAGCCCTGCAGTGGCTGGGAGG + Intergenic
1049600461 8:143505146-143505168 CCATCCCTGGAGGGGCTGGCGGG - Intronic
1049745501 8:144261558-144261580 GCCTCCCAGCAGAGGCTGTCAGG + Intronic
1056308816 9:85319535-85319557 TCTGCTCTGCAGTGGCTGTCTGG - Intergenic
1057187598 9:93065619-93065641 GCTGCCCTGCTGTGTCTGCCAGG + Intronic
1057617281 9:96602993-96603015 GTTTCCATCCAGTAGCTGGCTGG - Intronic
1057877326 9:98767939-98767961 GCAGCCCAGGAGTGGCTGGCTGG + Intronic
1060693058 9:125681886-125681908 GCTTGCCTGCAGTCCCAGGCTGG - Intronic
1061969330 9:134035489-134035511 GCTTCCCTGAAGTCAGTGGCAGG - Intronic
1062049237 9:134438585-134438607 GCTTCCTGGCAGTGCCTGGGAGG - Intronic
1062265155 9:135683550-135683572 GCTCCCCTGCAGTGGCCAGTGGG - Intergenic
1203630813 Un_KI270750v1:70924-70946 GAATACCTGCTGTGGCTGGCAGG + Intergenic
1187001111 X:15179335-15179357 GCTTCCCTGTAAAGGCTGGCTGG - Intergenic
1189320789 X:40085908-40085930 GCCTCTCTGCAGGGCCTGGCGGG + Intronic
1196102723 X:111864564-111864586 GCTCCCCTTCAGTGGGTGCCAGG + Intronic