ID: 999764209

View in Genome Browser
Species Human (GRCh38)
Location 5:154726081-154726103
Sequence CTGTGGAAGGCCAAGGTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265827
Summary {0: 8, 1: 1133, 2: 25627, 3: 79568, 4: 159491}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999764209_999764218 11 Left 999764209 5:154726081-154726103 CCGCCCACCTTGGCCTTCCACAG 0: 8
1: 1133
2: 25627
3: 79568
4: 159491
Right 999764218 5:154726115-154726137 CAGGTGTGAGCCACCGCACCTGG 0: 3711
1: 27757
2: 87460
3: 134376
4: 155663
999764209_999764216 -8 Left 999764209 5:154726081-154726103 CCGCCCACCTTGGCCTTCCACAG 0: 8
1: 1133
2: 25627
3: 79568
4: 159491
Right 999764216 5:154726096-154726118 TTCCACAGTGCTGGGATTACAGG 0: 88
1: 12765
2: 310723
3: 261915
4: 145751

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999764209 Original CRISPR CTGTGGAAGGCCAAGGTGGG CGG (reversed) Intronic
Too many off-targets to display for this crispr