ID: 999767544

View in Genome Browser
Species Human (GRCh38)
Location 5:154753035-154753057
Sequence CCTGCTGTGTAGAGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 549
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 490}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999767544 Original CRISPR CCTGCTGTGTAGAGGGTGGA GGG (reversed) Intronic
900526594 1:3132336-3132358 CCTGCTGGGTGGAGGGTGGATGG + Intronic
900735214 1:4295412-4295434 CCTGCTGATCAGAGGCTGGAAGG - Intergenic
900900791 1:5514247-5514269 CCTGCTCTGCAGAGAATGGATGG - Intergenic
901640087 1:10688713-10688735 CCTGCTGAGTCGAGGGTGTCAGG + Intronic
901919491 1:12526046-12526068 CCAGCTGTGGCGGGGGTGGAGGG + Intergenic
903062861 1:20682535-20682557 CCTGCTGTGTAAAGAGTAGAGGG + Intronic
904036785 1:27563411-27563433 CATGCTGTGTGGTGGGTGGAGGG - Intronic
904289017 1:29471710-29471732 CCTGCTGGGTGGGGGCTGGATGG - Intergenic
904558741 1:31382732-31382754 TCTGCTGTGTGGAGGCTGCATGG + Intergenic
905203925 1:36332071-36332093 TCAGTTGTGTAGAGGGTGAAGGG - Intergenic
905252046 1:36655774-36655796 GCTGCTGGGTGGAGGATGGAGGG + Intergenic
906461931 1:46041202-46041224 CCTGGTGTGTAGAGGGGGAGAGG - Exonic
906600385 1:47123095-47123117 CCTGTTGTGGGGTGGGTGGAGGG - Intergenic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907456742 1:54581204-54581226 GGTGCTGTGTGGAGGCTGGAAGG + Intronic
907515415 1:54990559-54990581 CCTGCTGTCTAGACCGAGGAGGG - Intronic
907892873 1:58651931-58651953 GCTTCAGTGTAGAGGATGGAGGG + Intergenic
907987460 1:59546402-59546424 CTTGCTCTGCAGAGGGTGGGAGG + Intronic
909685437 1:78343158-78343180 CCTGTTGTGGAGTTGGTGGAGGG - Intronic
909697184 1:78480789-78480811 CCTGTTGTGTGGTGGGGGGAGGG + Intronic
909980809 1:82098420-82098442 CGAACTGTGGAGAGGGTGGAGGG + Intergenic
910340374 1:86180453-86180475 CCTGTTGTGGGGAGGGGGGAGGG - Intergenic
911605758 1:99903283-99903305 CCTGTTGTGGAGTGGGGGGATGG - Intronic
913220155 1:116653632-116653654 CTGGGTGGGTAGAGGGTGGAAGG - Intronic
913294308 1:117303936-117303958 CCTGCTGTGAGGAGGAGGGATGG + Intergenic
914827747 1:151147312-151147334 GCTGCTTTGTAGAGGTGGGAGGG - Intergenic
915757449 1:158276477-158276499 CCTGTTGTGGGGTGGGTGGATGG - Intergenic
916201183 1:162273045-162273067 CTGGCTGTGTATAGGCTGGAGGG + Intronic
916213500 1:162376825-162376847 CCTGCTCTGGAGAGGCTGGCTGG + Exonic
916552832 1:165865396-165865418 CATGCTTTGCAGGGGGTGGAGGG - Intronic
916805042 1:168250945-168250967 CCTGCAGTGATTAGGGTGGAAGG - Exonic
917010918 1:170469863-170469885 CCTGTTGTGGAGTGGGGGGAGGG + Intergenic
917394714 1:174580623-174580645 CCTGCTGTGGGGTGGGAGGAGGG + Intronic
918338316 1:183544471-183544493 CCTGCTGGGAAGAGGAGGGAAGG - Exonic
918393880 1:184094469-184094491 GCGGCTGTGCAGAGGATGGAAGG + Intergenic
919014830 1:192019013-192019035 CCTGCTGTGGGGTGGGGGGAGGG + Intergenic
919513604 1:198494906-198494928 ACTGCTGTGGGGAGGGTGCAGGG - Intergenic
919796655 1:201325171-201325193 CCTGCTGTGCAGGGTGAGGAGGG - Intronic
919801795 1:201358867-201358889 CTAGCTGGGGAGAGGGTGGAGGG - Intergenic
919952908 1:202382266-202382288 CCTGTTGTGGAGTGGGGGGAGGG + Intronic
920327747 1:205179877-205179899 CCTTCTGAGTAGAGGATGGATGG - Intronic
920518180 1:206602211-206602233 CATGCTGTGGAAAGAGTGGAGGG - Intronic
920915229 1:210253268-210253290 CCTGCTGTGAGAAGGGTGGGTGG - Intergenic
922346550 1:224701162-224701184 ACTGCTATGCAGAGAGTGGAAGG + Intronic
922574560 1:226653311-226653333 CCTGCTGTCTCGAGACTGGAAGG - Intronic
922762128 1:228139849-228139871 CCTGCAGTGTAGATGGAGGACGG + Intergenic
922826126 1:228520837-228520859 CCTGCTGTGGGGTGGGGGGAGGG - Intergenic
923286242 1:232498647-232498669 CTTGCTGTGAAGATGGAGGAAGG - Intronic
923570485 1:235108787-235108809 AATGCTTTGGAGAGGGTGGAAGG - Intergenic
1063353166 10:5374481-5374503 CTTGCTGTGGGGAGGGAGGAAGG - Exonic
1063474437 10:6316206-6316228 CCAGCTGTGAAGAGTGTGGTTGG + Intergenic
1063607317 10:7534072-7534094 CCTGTGCTGTAGAGGGTGGGAGG - Intergenic
1066647859 10:37628267-37628289 CCTGCTGTGGGGTGGGGGGAGGG - Intergenic
1066687113 10:37991827-37991849 CTTACTGTGTGGAGGCTGGAAGG + Intergenic
1067066460 10:43106696-43106718 AGTGCTGGGCAGAGGGTGGAGGG - Intronic
1067137538 10:43624640-43624662 CCTCCTCTGGAGAGGGTTGAGGG - Intergenic
1067570340 10:47366914-47366936 CCTCCTGTGGAGGGGATGGATGG + Exonic
1067808228 10:49407880-49407902 CCTGCTGGGTGGAGAATGGATGG + Intergenic
1067901867 10:50250189-50250211 CCTGCTGGGTAGAGATTGGCAGG - Intergenic
1068025479 10:51637761-51637783 CCTGTTGGGCAGGGGGTGGAAGG + Intronic
1068628738 10:59277886-59277908 GCTGCTGAGTAGAGGGTGGCTGG - Intronic
1069193865 10:65524475-65524497 CCTGTTGTGGAGTGGGGGGACGG + Intergenic
1069194211 10:65528205-65528227 CCTGTTGTGGAGTGGGGGGACGG + Intergenic
1071710376 10:88043668-88043690 GCTGCTGTGTGGAGACTGGATGG + Intergenic
1072018402 10:91373073-91373095 CCTGTTGTGGGGTGGGTGGAGGG + Intergenic
1072394469 10:95024676-95024698 CCTGTTGTGGAGTGGGGGGAGGG + Intergenic
1072715769 10:97751477-97751499 CCTGCTGAGTAGAGGATGCTGGG - Intronic
1073026357 10:100489889-100489911 CCTGTTGGGTGGAGGGTGGCTGG - Intronic
1073989886 10:109250823-109250845 ACTGGAGTGCAGAGGGTGGAAGG - Intergenic
1075787094 10:125057403-125057425 CCTGTTGTTTAGAGGGAGGCGGG - Intronic
1076823723 10:132956644-132956666 CCTGTTGTGGGGAGGGAGGAGGG + Intergenic
1076888837 10:133274383-133274405 CAGGCAGGGTAGAGGGTGGAGGG + Intronic
1078133182 11:8630308-8630330 CCTGGGGTCTAGAGGGTGGGTGG - Intronic
1078854214 11:15193441-15193463 CCTGTTGTGGAGTGGGGGGATGG - Intronic
1079471105 11:20778376-20778398 CCTGATGTATAGAGTGAGGATGG - Intronic
1080815702 11:35754652-35754674 CCTGCTGTGGGGTGGGGGGAGGG - Intronic
1082311625 11:50656640-50656662 CCTGTTGTGTGGTGGGGGGATGG - Intergenic
1084636600 11:70397441-70397463 GCTGCTGTGTGGAAGATGGATGG - Intergenic
1084664558 11:70569447-70569469 TGTGCTGGGCAGAGGGTGGATGG + Intronic
1084666447 11:70578972-70578994 ACAGCTGGGCAGAGGGTGGATGG - Intronic
1084774609 11:71367264-71367286 CCTGCTGTGGGGTGGGGGGAGGG - Intergenic
1084979374 11:72821220-72821242 CCTGGTGTGGTGAGGATGGAAGG + Intronic
1085527090 11:77170555-77170577 ACTGCTGTGTTGAGAGTGTAAGG + Intronic
1086301399 11:85430202-85430224 CCTGTTGTGGGGAGGGGGGAGGG + Intronic
1087616774 11:100494661-100494683 CCTGTTGTGGGGAGGGGGGAGGG + Intergenic
1089209342 11:116790018-116790040 CCTGTTGGGTGGAGGGTGGAAGG - Exonic
1089699639 11:120236804-120236826 CCACCTGTGTATAGGGTTGAGGG - Intronic
1089949754 11:122514695-122514717 TCTGCCGTGGAGAGGATGGATGG + Intergenic
1091066038 11:132514055-132514077 CCTTCTGTGTAAAGTGTGTATGG + Intronic
1091643086 12:2252451-2252473 CGTGCTGAGTGGAAGGTGGAAGG + Intronic
1091753544 12:3037484-3037506 CCGGCAGTGGGGAGGGTGGAAGG - Intronic
1091805768 12:3354865-3354887 ACTGCTGTGTACAGGGGTGAAGG + Intergenic
1091844273 12:3643394-3643416 CCTGTTGTATGGAGGGGGGATGG + Intronic
1092054409 12:5496986-5497008 CCTGCTGTTTTAGGGGTGGAGGG - Intronic
1093093028 12:14942432-14942454 CCAGCTGTGGACAGGGAGGAGGG + Exonic
1093253701 12:16839691-16839713 CCTACTGGGTGGAGGGTGGGAGG + Intergenic
1094334168 12:29328735-29328757 CCTGTTGTGGAGTGGGGGGAGGG + Intronic
1095482803 12:42653179-42653201 CCTGTTGTGTGGTGGGGGGAAGG - Intergenic
1095576947 12:43751345-43751367 CCTGTTGTGGAGTGGGGGGAGGG - Intronic
1096230308 12:49893116-49893138 CCTGCAGCATGGAGGGTGGAAGG - Intronic
1096751093 12:53759276-53759298 CCTGCTGGGTAGAGGGTGGGAGG - Intergenic
1097508372 12:60505254-60505276 CCTGTTGTGGGGTGGGTGGAGGG - Intergenic
1097556581 12:61146554-61146576 CCTGTTGTGTGGTGGGTGGAGGG - Intergenic
1097563294 12:61235650-61235672 CCTGTTGTGGGGTGGGTGGAGGG - Intergenic
1099470149 12:83038130-83038152 CCTGCTGTGGGGTGGGGGGAGGG + Intronic
1099696135 12:86021581-86021603 CCTGCTGTGGGGTGGGGGGAGGG + Intronic
1099729071 12:86474363-86474385 CCTGCTGTGGGGTGGGGGGAGGG + Intronic
1101702795 12:107191034-107191056 CCTGTTGTGGAGTGGGAGGAGGG + Intergenic
1102149389 12:110678255-110678277 CCAGCTGTGAGGAGGGTGCAGGG - Intronic
1103724358 12:122990399-122990421 CCTGGTGGGTAGAGGGAGGGAGG - Intronic
1104291333 12:127471784-127471806 CCTGTTGTGGGGAGGGGGGAGGG + Intergenic
1104909878 12:132235597-132235619 GCTGCTGTGGGGTGGGTGGAAGG - Intronic
1105602671 13:21901243-21901265 CCTGTTGTGGGGTGGGTGGAGGG + Intergenic
1105895629 13:24715246-24715268 GCTTCTGTGTAGAGGATGGGAGG + Intergenic
1106044876 13:26129632-26129654 ACTGCTGTGTAGAGGGCAGAAGG - Intergenic
1106583062 13:31034125-31034147 CCTGGTGTTTAGAGGGCAGAAGG - Intergenic
1107295417 13:38902181-38902203 GCTGCTGTCTAGAGGGTGCTGGG + Intergenic
1107630352 13:42336347-42336369 CCGGCTTTGAAGAGGGAGGAAGG + Intergenic
1108243653 13:48493384-48493406 GCTGCTGTGTTGAGGAGGGAGGG - Intronic
1108445322 13:50503186-50503208 CCTGTTGTGGAGTGGGGGGAGGG - Intronic
1109372743 13:61445284-61445306 CCTTCTGGGTAGAGGGTTGGAGG + Intergenic
1109981734 13:69916583-69916605 CCTGTTGTGGAGTGGGGGGAAGG + Intronic
1110010046 13:70321063-70321085 CCTGTTGTGGGGAGGGGGGAGGG - Intergenic
1111331009 13:86762041-86762063 TCAGTTGTGTAGAGGGTGAAGGG + Intergenic
1112096983 13:96144795-96144817 CCTGTTGTGTGGTGGGGGGAGGG - Intronic
1112663253 13:101539200-101539222 CCTGTTGTGGAGTGGGGGGAGGG - Intronic
1112824491 13:103376177-103376199 CCTGTTGTGGGGTGGGTGGAGGG + Intergenic
1113098907 13:106695929-106695951 CATGCTGTGTGGAGCGTGGGTGG + Intergenic
1113283333 13:108815477-108815499 GCTGCTTTGAAGATGGTGGAAGG + Intronic
1113367008 13:109685471-109685493 CCAGCAGGGGAGAGGGTGGAAGG + Intergenic
1113676598 13:112211540-112211562 CCTGCTGTGTAGACAGTGCTGGG - Intergenic
1113724297 13:112587308-112587330 CCTACTGTTTAAAGGGTTGAAGG - Intronic
1114479453 14:23023261-23023283 CCTGGTGTGCAGATGCTGGAAGG + Intronic
1114765061 14:25361451-25361473 ACTGTTGTGGAGTGGGTGGAGGG + Intergenic
1116444090 14:44988098-44988120 CCTGCTGTGAGGTGGGGGGAGGG + Intronic
1116756362 14:48953675-48953697 CCTGTTGTGGGGAGGGGGGAGGG - Intergenic
1117446546 14:55808698-55808720 CCTGTTGTGGAGTGGGGGGAGGG - Intergenic
1117516028 14:56502140-56502162 GCTGGGGTGTGGAGGGTGGAGGG - Intronic
1117948122 14:61053032-61053054 GCTGGTGGGTAGAGGGTGGGAGG - Intronic
1118887250 14:69877983-69878005 GCTGCCGTGTGGAGGTTGGATGG + Intronic
1121641560 14:95487880-95487902 CTTGCTGTCTCGAGGGTGGCAGG - Intergenic
1122259584 14:100506070-100506092 ACTGTGGTCTAGAGGGTGGAGGG - Intronic
1122323566 14:100869354-100869376 CCTGCTGTGTGGAGCCTGGAGGG + Intergenic
1122323753 14:100870396-100870418 CCTGCTGTGTGGAGCCTGGAGGG + Intergenic
1122587567 14:102820023-102820045 CCTCCCGTGTAGGGGGTGGGTGG + Intronic
1122699996 14:103581916-103581938 CCTGCTCTGTGGAGGGAGGGTGG + Intronic
1123434353 15:20244334-20244356 CCTGCTGTGAAGATGCTGGTGGG - Intergenic
1123885684 15:24725712-24725734 CCTGTTGTGTGGTGGGGGGAGGG - Intergenic
1124670530 15:31634644-31634666 CCTGCTGTATACAGGGCAGATGG - Intronic
1125709055 15:41769035-41769057 TCTGCTGGGTAAAGAGTGGAAGG - Exonic
1126016276 15:44354292-44354314 CCTGTTGTGTAGTGGGGGGAGGG + Intronic
1126724627 15:51619836-51619858 CCTGCTCTGGAGAGGGTGTGTGG - Intronic
1127211018 15:56774769-56774791 CTTCCTGTTCAGAGGGTGGAGGG - Intronic
1127810469 15:62561006-62561028 CCTTCTGTGTAGAGGAAGAATGG - Intronic
1129253365 15:74320549-74320571 CCTGCTGGGGAGCAGGTGGAAGG + Intronic
1131694344 15:94859095-94859117 ACTGCCAGGTAGAGGGTGGAGGG - Intergenic
1132018510 15:98339793-98339815 CTGGCTTTGAAGAGGGTGGAAGG - Intergenic
1132379895 15:101359041-101359063 CCTGCTGTGTGTGGGGAGGACGG - Intronic
1133233043 16:4375257-4375279 CCTCCTGGGTGGAGGGAGGAGGG + Intronic
1133336580 16:5010565-5010587 CCCGGTGGGGAGAGGGTGGAGGG + Intronic
1133973039 16:10580653-10580675 CCCGCCGCCTAGAGGGTGGAGGG - Exonic
1134080201 16:11319699-11319721 CCTGCTCTGCAAAGGGAGGATGG - Intronic
1134095170 16:11414248-11414270 CCCGCTGTGTGCAGGGTGGGTGG - Intronic
1136850260 16:33606761-33606783 CCTGCTGTGAAGATGCTGGTGGG + Intergenic
1137049947 16:35700629-35700651 TCTGTTGTGGAGTGGGTGGAGGG + Intergenic
1137068292 16:35874064-35874086 CCTGCTGTGGGGTGGGGGGAGGG - Intergenic
1137345550 16:47654795-47654817 CCTGTTGTGTGGTGGGGGGAGGG + Intronic
1138480991 16:57303409-57303431 GCTGCTGTGTGGAGGATGGACGG + Intergenic
1138677825 16:58664962-58664984 CCTGCTTGGTAGAGGGAGCATGG + Intergenic
1140197158 16:72864783-72864805 CCTGCTATGTAGATGATTGATGG - Intronic
1140409769 16:74734614-74734636 CCTGCTGCCCAGAGGGTGGGCGG + Intronic
1140775249 16:78243509-78243531 ACTGGAGGGTAGAGGGTGGAAGG - Intronic
1141173531 16:81705163-81705185 CCTGCTGGGTGGACAGTGGAAGG - Intronic
1141200178 16:81891678-81891700 CCTGTTGTGAAGCAGGTGGAGGG + Intronic
1141286569 16:82678165-82678187 CATGCTGTGTATTGGATGGATGG + Intronic
1141709663 16:85690591-85690613 CCTGCAGTGTTCAGGGAGGAGGG + Intronic
1141934537 16:87228557-87228579 GCTCCTGTGTACAGGGTGGGTGG - Intronic
1203111873 16_KI270728v1_random:1455214-1455236 CCTGCTGTGAAGATGCTGGTGGG + Intergenic
1143889414 17:10091126-10091148 GCTGCTGGGTAGAGGATGAATGG - Intronic
1145757687 17:27404675-27404697 CCTGGTCTGGAGAGGGAGGAGGG - Intergenic
1146240703 17:31221081-31221103 TCTGCTGGGTTGGGGGTGGAGGG + Intronic
1147343618 17:39771669-39771691 CCTGGAGTGCAGAGGGAGGATGG + Intronic
1147819093 17:43231293-43231315 CCTGCTTTGTTGAGGGAGGGAGG - Intergenic
1147832376 17:43305998-43306020 CCTGCTTTGTTGAGGGAGGGAGG - Intergenic
1149610664 17:57955748-57955770 CCAGCTGCGGAGAGGGTGGGCGG + Intergenic
1151766088 17:76133951-76133973 CCTCCTGTGTAGAGAGTAGCTGG + Intergenic
1152413305 17:80142394-80142416 CCTGCTGTGGAGCAGGTGAAAGG - Intronic
1152586067 17:81190033-81190055 CCTGCAGTGCACAGGGTGCACGG + Intronic
1153694810 18:7629491-7629513 GTTGCTGGGTAGAGGGTGGTGGG + Intronic
1153764711 18:8364623-8364645 CCCGCTGAGAAGAGGGTGGATGG - Intronic
1154122778 18:11665067-11665089 GATGCTGTGCAGAGGGTGGCAGG - Intergenic
1154378307 18:13827011-13827033 CCTGCTAGGTGGAGGGTGGATGG - Intergenic
1154413154 18:14153805-14153827 TCTGCTGGGTTGGGGGTGGAGGG - Intergenic
1156505954 18:37593028-37593050 CCTTCTGTGTAAAGGCTGAATGG + Intergenic
1156559804 18:38110963-38110985 CCTGTTGTGGAGTGGGGGGAGGG - Intergenic
1156930571 18:42637618-42637640 CCTGTTGTGGAGTGGGGGGAGGG + Intergenic
1157169660 18:45391077-45391099 CCTGTTGTGGGGTGGGTGGAGGG - Intronic
1157196670 18:45625479-45625501 CCTGCTGTGAAGAAGGTGCATGG + Intronic
1158052397 18:53239037-53239059 CCTGTTGTGGAGTGGGGGGAGGG + Intronic
1158190077 18:54817714-54817736 CTGACTGTGTAGAAGGTGGATGG - Intronic
1159945129 18:74438988-74439010 CCAGGAATGTAGAGGGTGGAAGG - Intronic
1160351968 18:78190270-78190292 CCTGTTGTGGAGTGGGGGGAGGG + Intergenic
1161270094 19:3385029-3385051 CCTGCTGAGCAGAGGCGGGAGGG - Intronic
1162237371 19:9319797-9319819 CCTGTTGTGTGGTGGGGGGAGGG + Intergenic
1162287159 19:9747430-9747452 CCTGCTGGGGGGAGGGGGGAGGG - Intergenic
1163226970 19:15969651-15969673 CCTGTTGTGGGGTGGGTGGAGGG + Intergenic
1163883638 19:19947819-19947841 TCAGCTGTGTAGAGGGTGAAAGG - Intergenic
1164400136 19:27896467-27896489 CCTCCAGGGTGGAGGGTGGAAGG + Intergenic
1164615046 19:29662805-29662827 ACAGCTGGGTGGAGGGTGGAGGG - Intergenic
1164933380 19:32192519-32192541 CCTGTTGTGGGGAGGGGGGAGGG - Intergenic
1164944466 19:32281826-32281848 CCTGTTGTGGGGAGGGGGGAGGG - Intergenic
1165030584 19:32995456-32995478 CCTGCTGTGAAGATGCTGGTGGG - Intronic
1165135311 19:33664440-33664462 CCTGTTGTGGGGAGGGGGGAGGG - Intronic
1165135472 19:33665757-33665779 CCTGATGGGTAGAGGGTGGAGGG + Intronic
1165380021 19:35472596-35472618 ACTGCAATGTAGAGAGTGGATGG - Intergenic
1165930626 19:39356154-39356176 AATGCTGGGTAGAGGATGGATGG - Intronic
1166443607 19:42838639-42838661 TCTGCAGTGCAGATGGTGGAAGG + Intronic
1166463300 19:43009301-43009323 TCTGCAGTGCAGATGGTGGAAGG + Intronic
1166480574 19:43169397-43169419 TCTGCAGTGCAGATGGTGGAGGG + Intronic
1166877126 19:45904045-45904067 CCTGCTGTGTGGAGGGTGGGTGG + Intergenic
1167158917 19:47755329-47755351 CCCGCTGTGGAGACGGGGGAGGG - Exonic
925046142 2:774112-774134 CCTGCTGTGGGGAGGCAGGATGG - Intergenic
925080138 2:1056738-1056760 CCTGCTGTGGGGAGGGAGGGAGG + Intronic
925215769 2:2094765-2094787 CCTGCTGTGGGGTGGGGGGAGGG + Intronic
925477899 2:4239094-4239116 CCTGTTGTGGAGTGGGGGGAGGG + Intergenic
925756675 2:7139395-7139417 CCACCTGTGGAGGGGGTGGAGGG + Intergenic
925950524 2:8905648-8905670 CCTGTTGTGTGGTGGGGGGATGG + Intronic
926413054 2:12625019-12625041 CCTGTTTTGAAGAGGGTGGTAGG + Intergenic
926455381 2:13061091-13061113 CCTGTTGTGTAGTGGGGGTAGGG + Intergenic
926896347 2:17693538-17693560 CCGGCTGTGTGGTGGGGGGAGGG + Intronic
927881338 2:26692176-26692198 TATGCTGTGATGAGGGTGGAGGG + Intergenic
928126098 2:28617741-28617763 CTTCCTGTGTACAGAGTGGAAGG + Exonic
928200783 2:29246479-29246501 CATGGTGTCTAGAGGGTGGGTGG - Intronic
928400883 2:30977953-30977975 ACGGCTGTGGAGAGGGTGGGAGG - Intronic
928815685 2:35292311-35292333 CCAGCTCTGATGAGGGTGGAAGG + Intergenic
928820828 2:35358652-35358674 CCTGTTGTGGAGTGGGGGGAGGG - Intergenic
929455956 2:42065767-42065789 CCTGCTGTGGGGTGGGGGGAGGG - Intergenic
929771229 2:44893807-44893829 GCAGCTGTGTTGAGGGTTGATGG + Intergenic
930028719 2:47045396-47045418 CCTGCTGTGTCCAGGGTAGAGGG + Intronic
931151192 2:59575337-59575359 CCTGCTATATAGAGGGTAGATGG + Intergenic
931160865 2:59688850-59688872 CCTGTTGTGTGGTGGGGGGAGGG + Intergenic
932011176 2:67978712-67978734 CATGCTGTGTAGGGGAAGGAAGG - Intergenic
932061924 2:68510061-68510083 CCTGTTGTGGAGTGGGGGGAGGG + Intronic
932577015 2:72968316-72968338 CAGTTTGTGTAGAGGGTGGAAGG - Intronic
933231313 2:79810675-79810697 CCTGTTGTGGAGTGGGGGGAGGG - Intronic
933364361 2:81330609-81330631 AGTGTTTTGTAGAGGGTGGAAGG - Intergenic
933601771 2:84339309-84339331 CCTGTTGTGGGGTGGGTGGAGGG + Intergenic
934549841 2:95252233-95252255 CCTGCTGTGTGGTGGGGGGAGGG - Intronic
934662082 2:96148455-96148477 CCTGCTGTGCAGGGGGCTGATGG - Intergenic
935717995 2:105955357-105955379 CCTCCTGTGCTGTGGGTGGAAGG - Intergenic
936642684 2:114333256-114333278 CCTGTTGTGTGGTGGGGGGAGGG - Intergenic
936816313 2:116465184-116465206 TCTGCTGTGTAGAGAGTCCATGG + Intergenic
937059022 2:118967699-118967721 CCTGCTGTGCGGGGGTTGGAAGG + Intronic
937200905 2:120204051-120204073 TCTGCTCTAGAGAGGGTGGAAGG + Intergenic
937431690 2:121844077-121844099 CCTGCTGTGACGAGGGTGGTTGG + Intergenic
937699924 2:124852637-124852659 ACTGCTGTGTAGGGAATGGATGG + Intronic
939072551 2:137560555-137560577 CCTGTTGTGGGGTGGGTGGAAGG + Intronic
940026022 2:149209245-149209267 GCTGCTGTGTGGAGAATGGAGGG + Intronic
941159219 2:162017121-162017143 GCTGCTGTGTAGAGTATAGAGGG + Exonic
942968347 2:181925408-181925430 CATGCTATGGAGAGGTTGGAAGG - Intronic
942984112 2:182119052-182119074 CCTGCTGTGGGGTGGGTGGTGGG - Intronic
946716233 2:222556968-222556990 ACTGCAGTGGGGAGGGTGGATGG - Intronic
946805662 2:223468997-223469019 CCTGCTCTGTAGAGGGCAGCTGG - Intergenic
947074595 2:226328603-226328625 CCTGTTGTGGAGTGGGGGGAGGG + Intergenic
947141949 2:227027470-227027492 CCTGTTGTGGAGTGGGAGGAGGG + Intronic
947258985 2:228199284-228199306 CCTGTTGTGGAGTGGGGGGAGGG - Intergenic
947590009 2:231380098-231380120 CGTGATGTGGAGAGGGTGGGTGG + Intergenic
947910962 2:233800412-233800434 CCTGCTGTCTGGAGTGTTGAGGG + Intronic
948047179 2:234952935-234952957 CCTGCGGTGTAGACGGGGGTTGG + Intronic
948063272 2:235057637-235057659 CCTGTTGTGGAGTGGGGGGAGGG - Intergenic
948070540 2:235118817-235118839 CCTGTTGTGGAGTGGGGGGAGGG - Intergenic
948179261 2:235966726-235966748 CCTCCTGCGAAGAGGGTGAAGGG - Intronic
948469459 2:238167820-238167842 CCACCTCTGGAGAGGGTGGAAGG - Intronic
948807989 2:240461181-240461203 GCCGCTGTGGGGAGGGTGGACGG - Intronic
1168774587 20:437206-437228 CCTGTTGTGTGCAGGGTGGAGGG - Exonic
1170701806 20:18710818-18710840 CCTCCTGTGTAGAGCCAGGAAGG + Intronic
1173009614 20:39170052-39170074 CATGCAGACTAGAGGGTGGAAGG - Intergenic
1173751545 20:45480493-45480515 CCTCCTGAGTAGCGGGTGGGTGG - Intronic
1174448749 20:50607598-50607620 CCTGAAGTGTACAGGGTGGCGGG - Intronic
1174750727 20:53108949-53108971 CTTGGAGGGTAGAGGGTGGAGGG - Intronic
1175323723 20:58107930-58107952 GATGCTCTGTAGAGGATGGAGGG - Intergenic
1175520033 20:59596727-59596749 CCTGCTGAGCAGAGCTTGGAAGG - Intronic
1175953383 20:62595810-62595832 CCTGCTGTGGAGGGGCTGGCGGG + Intergenic
1177451035 21:21266714-21266736 CCTGTTGTGGGGTGGGTGGAGGG + Intronic
1179885171 21:44310807-44310829 CCAGCTGTGCAGAGGGTGTCTGG + Intronic
1180141486 21:45896042-45896064 CCTGCTGGGCACAGGGTGCACGG - Intronic
1180196197 21:46195784-46195806 CCGGCTGTGAACAGGGTGGAAGG - Intronic
1182094631 22:27617731-27617753 CCAGCTGTGTTGAGGGTAGATGG + Intergenic
1182394104 22:30022760-30022782 CCTGCAGAGTAGAGGGTTGTGGG + Intronic
1183036445 22:35144262-35144284 CCCGCTGTGGAGGGGGTGGGGGG + Intergenic
1183426372 22:37741530-37741552 CCTGCTGTGAAGCGGGTGGGAGG - Intronic
1184232997 22:43168591-43168613 CCTGCGGTGCAGAGTCTGGAGGG - Intronic
1184782308 22:46655521-46655543 CCAGATGTGTAGGGGGTGAAGGG + Intronic
1184892984 22:47390741-47390763 CCTGCTGAGCAGCAGGTGGAGGG - Intergenic
1185148118 22:49150179-49150201 CCAGCTGTGTGGAGGGAGCAGGG - Intergenic
949268949 3:2191877-2191899 CCTGTTGTGGAGTGGGGGGAGGG - Intronic
949359274 3:3214654-3214676 TCTGCTCTCTAGAGGGTAGAAGG - Intergenic
950047699 3:9959839-9959861 CCTGCAGTGTAGAGTATGAAAGG - Intergenic
950905157 3:16531093-16531115 CCTGTGGTGTAGAGGATGGCTGG + Intergenic
951802659 3:26613559-26613581 ACTGCTGTGCAGAGAATGGAAGG + Intergenic
952253781 3:31678329-31678351 CATGCTGTGTAGAGGGAAGAAGG + Intronic
953241818 3:41156128-41156150 CCTGCTTTGTGGAATGTGGATGG - Intergenic
953392652 3:42542793-42542815 CCTGCTTTGTTGGGGTTGGAAGG - Intergenic
953981432 3:47415089-47415111 CCTGCAGTTTAGAGGTCGGAGGG - Exonic
954989235 3:54825255-54825277 CCTTCTGTGTAGAAGGAAGAAGG - Intronic
956048073 3:65217822-65217844 CCTGTTGTGGAGTGGGTGGAAGG - Intergenic
956277072 3:67513982-67514004 TCCGCTGGGTAGAGGGTCGAGGG - Intronic
956395027 3:68816158-68816180 CCTGTTGTGGAGTGGGGGGAGGG + Intronic
957550529 3:81697786-81697808 CCTGCTTTGGAGCAGGTGGAAGG + Intronic
958092479 3:88894048-88894070 CCTGTTGTGGGGTGGGTGGAGGG + Intergenic
958111290 3:89149631-89149653 CCTGTTGTGGGGAGGGGGGAGGG - Intronic
958198095 3:90268209-90268231 ACTGTTGTGTGGTGGGTGGAGGG + Intergenic
958692722 3:97488490-97488512 CCTGCTGGGTTGAGGGTGGCAGG - Intronic
958705971 3:97655749-97655771 CCTGTTGTGGAGTGGGGGGAGGG + Intronic
958811466 3:98864697-98864719 CCTGTTGTGGGGTGGGTGGAGGG + Intronic
959039670 3:101406426-101406448 CCTGTTGTGGAGTGGGGGGAGGG + Intronic
959257816 3:104036927-104036949 CCTGTTGTGTGGTGGGGGGAGGG - Intergenic
961421341 3:126807041-126807063 CCTGCTGTGGGGTGGGGGGAGGG + Intronic
961478384 3:127163325-127163347 CAGGCTTTGGAGAGGGTGGAAGG + Intergenic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
962260344 3:133898186-133898208 CCAGCTGTGTAGAGGGTAAATGG - Intergenic
962531307 3:136283391-136283413 CCTTCTGTGGAGGGTGTGGAGGG + Intronic
962811416 3:138961979-138962001 GCTGCAGTGTGGAGGATGGAGGG + Intergenic
962818811 3:139026771-139026793 CCTGTTGTGGAGTGGGGGGAGGG - Intronic
962828185 3:139118130-139118152 GCTGCTGTCTTGGGGGTGGATGG + Intronic
963757902 3:149255341-149255363 TCTGCAGTGTAGAGGTGGGAGGG + Intergenic
965252332 3:166358307-166358329 CCTGTTGTGGGGTGGGTGGAGGG - Intergenic
966408013 3:179619348-179619370 CCTGTTGTGGGGTGGGTGGAGGG - Intronic
966546996 3:181160499-181160521 CCTGCTGTGGGGTGGGGGGAGGG - Intergenic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967125160 3:186416687-186416709 CCTGTTGTGGAGTGGGGGGAGGG - Intergenic
967737268 3:192965986-192966008 CCTGTTGTGGGGTGGGTGGATGG - Intergenic
967947387 3:194814835-194814857 CCTGCAGTGTGAAGGGTGGGAGG + Intergenic
968636815 4:1684965-1684987 CCTGCAGAGGAGAGGGTGGCGGG + Intergenic
968925993 4:3548768-3548790 GGTGCTGTGTGGAGGGTGGCGGG + Intergenic
969122443 4:4920145-4920167 CCAGCTGTGCAGAGGTTGGCCGG - Intergenic
969186800 4:5480730-5480752 CCTGTTGTGGGGTGGGTGGAGGG - Intronic
970895874 4:21103732-21103754 CCTGTTGTGTGGTGGGGGGAGGG - Intronic
971096851 4:23416374-23416396 CCTGTTGTGGGGAGGGGGGAGGG - Intergenic
971304192 4:25465914-25465936 ACTGCTGTGTGGAGAGTAGATGG + Intergenic
971750895 4:30646486-30646508 CCTGTTGTGGAGTGGGGGGAGGG + Intergenic
971851921 4:31995164-31995186 CATGCTTTGAAGGGGGTGGAGGG + Intergenic
971864841 4:32156298-32156320 CCTGTTGTGGGGAGGGAGGAGGG - Intergenic
971867539 4:32191391-32191413 CCTGTTGTGCAGTGGGGGGAGGG + Intergenic
972048870 4:34702885-34702907 CCTGCTCTGGAGATGGTGGCAGG - Intergenic
973049393 4:45576034-45576056 CCTGTTGTGGGGTGGGTGGAGGG + Intergenic
973065392 4:45783551-45783573 CCTGTTGTGGGGTGGGTGGAGGG + Intergenic
973778177 4:54262791-54262813 CCTGCTGTGAAGAGAATGGTAGG + Intronic
974521996 4:62994213-62994235 CCTGTTGTGGAGTGGGGGGAGGG - Intergenic
974642081 4:64644248-64644270 ACTTCAGGGTAGAGGGTGGAAGG - Intergenic
975037608 4:69704012-69704034 CCTGATGTGTTAAGGGTGGAAGG + Intergenic
975173758 4:71263011-71263033 CCTGTTGTGGAGTGGGGGGAGGG - Intronic
975803615 4:78089272-78089294 CCTGTTGTGTGGTGGGGGGAGGG + Intronic
977248226 4:94659442-94659464 CCTGCTGTTTGGAGGTTGGAAGG - Intronic
978378279 4:108098221-108098243 TATGCAGTTTAGAGGGTGGAAGG + Intronic
979396560 4:120196489-120196511 CCTGCAGTGAAGAGTCTGGATGG - Intergenic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
981259357 4:142701284-142701306 CCTACTGTGGAGAGGCTGGCAGG - Intronic
982896459 4:160933918-160933940 CCTGAAGGGTCGAGGGTGGAAGG + Intergenic
983115476 4:163810849-163810871 TCTGCTTTGTGGAAGGTGGATGG - Intronic
983185876 4:164699987-164700009 GCTTGTGTGTTGAGGGTGGAGGG + Intergenic
983282059 4:165693497-165693519 CCTGCTGTGGGGTGGGGGGAGGG + Intergenic
983523572 4:168736671-168736693 CCTGATGTTCAGATGGTGGATGG - Intronic
983783605 4:171703911-171703933 CCTGCTGTGGGGTGGGGGGAGGG + Intergenic
983876066 4:172875599-172875621 CCTGCTGTTCAGTAGGTGGATGG - Intronic
984764017 4:183385733-183385755 CCTGGAGTGTGGAGGGTGGGAGG + Intergenic
984943177 4:184951899-184951921 CCTGGTGTGTATGGGGTGGGGGG + Intergenic
985495282 5:200829-200851 CCTGCTGTGTAGAAAGTGCTGGG - Exonic
985495289 5:200867-200889 CCTGCTGTGTAGACGCTGGCTGG - Exonic
985495302 5:200943-200965 CCTGCTGTGTAGACGCTGGCTGG - Exonic
985495315 5:201015-201037 CCTGCTGTGTAGACACTGGCTGG - Exonic
985495323 5:201054-201076 CCTGCTGTGTAGACACTGGCTGG - Exonic
985730707 5:1546719-1546741 CCTGCTTTGCAGAGGATGGAAGG - Intergenic
986239846 5:5951279-5951301 CCTGCTCTGGAGTTGGTGGAGGG + Intergenic
986439239 5:7763913-7763935 CCTGCTGTTGACTGGGTGGATGG + Intronic
986528845 5:8712620-8712642 CCTGTTGTGGAGCGGGGGGAGGG - Intergenic
989661087 5:43798302-43798324 CCTGCTGTGGGGTGGGAGGAGGG - Intergenic
989941935 5:50161143-50161165 CCTGTTGTGGGGTGGGTGGAGGG + Intergenic
990153603 5:52848725-52848747 CCTGTTGTGTGGTGGGGGGAGGG - Intronic
990608818 5:57437333-57437355 GATGCTGTGTAGCAGGTGGATGG + Intergenic
990753628 5:59043703-59043725 CCTGCTGTGGGGTGGGGGGAAGG - Intronic
991544235 5:67763529-67763551 CCTGATGTGGAGTGGGGGGAGGG + Intergenic
992549800 5:77849714-77849736 CCTTCTCTGGAGAGGGTGCAGGG + Intronic
993117722 5:83737265-83737287 CCTGTTGTGTGGTGGGGGGAGGG - Intergenic
994154676 5:96489776-96489798 CCAGCTGTGTAGAGAGAGCAGGG - Intergenic
994645073 5:102458094-102458116 CCTGTTGTGGGGTGGGTGGAGGG + Intronic
994859253 5:105167338-105167360 CCTGAATTGTAAAGGGTGGAGGG - Intergenic
996199233 5:120650476-120650498 CCTGTTGTGGAGTGGGGGGAGGG - Intronic
997116700 5:131133075-131133097 CCTGTTGTGTGGTGGGGGGAGGG - Intergenic
998135562 5:139672608-139672630 CCTGAGGTCTGGAGGGTGGAGGG + Intronic
998931198 5:147183348-147183370 CCTGTTGTGGAGTGGGGGGAGGG - Intergenic
999223275 5:149999395-149999417 ACTGCTGTGTAAAGAATGGAAGG + Intronic
999275238 5:150325654-150325676 CTTGGTGTGCAGAGGGTGGAGGG - Intronic
999767544 5:154753035-154753057 CCTGCTGTGTAGAGGGTGGAGGG - Intronic
999846470 5:155486476-155486498 CCTGTTGTGTGGTGGGGGGAGGG - Intergenic
1000245097 5:159442504-159442526 CCAGGGATGTAGAGGGTGGAAGG - Intergenic
1002393551 5:178935770-178935792 CCTCCTCTATAGAGGCTGGAAGG - Intergenic
1002494942 5:179605453-179605475 CCTGCTGTCTGGAAGGGGGAAGG - Intronic
1002877664 6:1226046-1226068 CCTGTTGTGGGGTGGGTGGAGGG - Intergenic
1002934363 6:1659146-1659168 CCTGCTCTGTGGAGGGAGGCTGG + Intronic
1003764147 6:9216489-9216511 CCTGTTGTGGGGTGGGTGGAGGG - Intergenic
1004840336 6:19576746-19576768 CCTGTTGTGCAGTGGGGGGAGGG + Intergenic
1005074066 6:21889792-21889814 CCAGCTATGTGGAGGCTGGATGG + Intergenic
1005779634 6:29176746-29176768 CCTGTTGTGTGGTGGGGGGAGGG - Intergenic
1005923152 6:30418280-30418302 CCTGGAGTGCAGAGGGTGGGTGG + Intergenic
1006272315 6:32973699-32973721 CGTGTTGTGTAGTGGGTGGGTGG + Intronic
1006920249 6:37623185-37623207 CCTGGGGTGTAGAGGCAGGAAGG + Intergenic
1006944723 6:37777766-37777788 ACTGCTGTGTTGTGGGGGGACGG + Intergenic
1008281823 6:49604512-49604534 CCTGTTGTGTGGTGGGGGGAGGG + Intergenic
1009648287 6:66438308-66438330 CCTGGTGAGGAGATGGTGGAGGG + Intergenic
1010357528 6:74951613-74951635 GCTGCTGGGTATAGGGTGGTGGG - Intergenic
1011598948 6:89042132-89042154 CCTGCTGTGGGGTGGGGGGAGGG + Intergenic
1012332302 6:98008279-98008301 CCTGTTGTGGAGTGGGGGGAGGG - Intergenic
1012726882 6:102824910-102824932 CCTGCTGTGGGGTGGGGGGAGGG - Intergenic
1012778612 6:103528210-103528232 CCTGCTGTGGGGTGGGGGGATGG + Intergenic
1013168757 6:107617390-107617412 CCTGCCTTTTAGAGGGTGGCTGG - Intronic
1013399902 6:109783109-109783131 CCTGCAGTGGTGAGGGTGGAAGG + Intronic
1013624132 6:111920211-111920233 CCTGCTGTGGGGAAGGTGCAGGG + Intergenic
1013647914 6:112163517-112163539 CCTGGTGTTTAGAGGAGGGAGGG + Intronic
1014529830 6:122545632-122545654 CCTTCTTTGTGGAGGGTGGCAGG + Intronic
1015468720 6:133577635-133577657 CCTGTTGTGGGGTGGGTGGAGGG + Intergenic
1015521552 6:134136521-134136543 CCTGCTGTGGAGTGGGGGGAGGG - Intergenic
1015640612 6:135327732-135327754 CCTCCAGGGTAGAGGGGGGAAGG - Intronic
1015930620 6:138355761-138355783 CCTGTTGTGGGGAGGGGGGAGGG - Intergenic
1016638536 6:146322751-146322773 ACTGCTGTGGGGTGGGTGGAGGG - Intronic
1017845750 6:158256875-158256897 CCTTCTGTGTAAAGGTGGGAGGG + Intronic
1018589256 6:165399573-165399595 CCTGTTGTGGGGAGGGGGGAGGG - Intronic
1018730990 6:166650369-166650391 CCAGCTGTCTAGAGGTGGGAGGG + Intronic
1018797864 6:167201196-167201218 CCGGCTGTGTGGAGTGAGGATGG - Intergenic
1019405322 7:880529-880551 CCTGCTGTCTAGAGGGCTTAAGG - Intronic
1019667603 7:2259570-2259592 CCTGAGGTCTGGAGGGTGGAAGG - Intronic
1019696129 7:2447040-2447062 CCTGATGTGCTGAGGGTGCAGGG + Intergenic
1019913558 7:4116314-4116336 CTGGCTGTCTCGAGGGTGGAGGG - Intronic
1019937304 7:4264954-4264976 TCTCCTGTGTGGAGGGTGGGAGG + Intronic
1020620134 7:10506933-10506955 CCTGCTGTGGGGTGGGGGGAGGG + Intergenic
1021435043 7:20604427-20604449 CCTGTTGTGTGGTGGGGGGAGGG - Intergenic
1022509449 7:30925888-30925910 CCTGCTCTGTGGAGGGTAGAGGG - Intergenic
1023821895 7:43985310-43985332 CCTGAGGTGTGGAGGGTGGAGGG - Intergenic
1024167255 7:46747257-46747279 ACTGGTGTCTAGAGGGAGGAAGG - Intronic
1024291106 7:47804926-47804948 CCTCCTGTGGACAGAGTGGAAGG + Intronic
1024444464 7:49460648-49460670 CCTGCTGTGGGGTGGGGGGAGGG + Intergenic
1025109309 7:56200141-56200163 CCTGTTGTGGGGAGGGGGGAGGG - Intergenic
1025788779 7:64668304-64668326 CCTGCTGTGGGGTGGGGGGAGGG - Intronic
1026360983 7:69600206-69600228 TCTGCTGTGGAGGGGGTGCAGGG - Intronic
1027539178 7:79446159-79446181 CCTGTTGTGCAGTGGGAGGAGGG + Intronic
1028474135 7:91235235-91235257 CCTGCTGTGTAGCGTTTTGAGGG + Intergenic
1028513432 7:91650209-91650231 CCTGTTGTGGAGTGGGGGGAGGG + Intergenic
1029593278 7:101521413-101521435 CCAGTTGTGTACAGGGTGCATGG + Intronic
1029747282 7:102523184-102523206 CCTGGTGTGTTGAGGCTGGCCGG - Intergenic
1029750160 7:102538732-102538754 CCTGAGGTGTGGAGGGTGGAGGG - Intronic
1029765235 7:102622274-102622296 CCTGGTGTGTTGAGGCTGGCCGG - Intronic
1029768111 7:102637840-102637862 CCTGAGGTGTGGAGGGTGGAGGG - Intronic
1029980030 7:104870084-104870106 CCTGCTGTGGGGTGGGGGGACGG + Intronic
1030005254 7:105112271-105112293 CCTGCTGAGTATTGGCTGGAAGG - Exonic
1030465702 7:109900923-109900945 CCTGTTGTGGGGTGGGTGGAGGG + Intergenic
1031259009 7:119492471-119492493 ACTGCTGTGGGGTGGGTGGAGGG + Intergenic
1031427309 7:121621363-121621385 CCAGCTGTGCAGAGGGAGGACGG - Intergenic
1031986426 7:128167163-128167185 CGTGCTAGGTAGAGGGTGGGAGG + Intergenic
1033970990 7:147039360-147039382 CCTGGAGAGTGGAGGGTGGAAGG - Intronic
1034220473 7:149441074-149441096 CCTGCTGTTTAGCAAGTGGAGGG - Intronic
1034355751 7:150449690-150449712 CCTGCTGTGCAGAGCGCAGAGGG + Intergenic
1034933660 7:155183933-155183955 ACTGCTGCTTAGAGGGTGGCAGG - Intergenic
1034964556 7:155383152-155383174 CCTGCAGGGTAGAGGCTGGAGGG - Intronic
1035485806 7:159225064-159225086 TCTGCTGTGTAGAGAGTAGGTGG - Intergenic
1035774509 8:2177941-2177963 TCTGGAGGGTAGAGGGTGGAAGG - Intergenic
1036759650 8:11498592-11498614 CCTGCAGTGTAGTGGTTAGACGG + Intronic
1038892754 8:31745201-31745223 CCTGCTGAGTAGCTGGTGGAAGG + Intronic
1039453478 8:37693922-37693944 ACTGCTGTGTAGAGCGGGAAGGG - Intergenic
1040067023 8:43154342-43154364 CCTGCTGTGCGGTGGGGGGAGGG - Intronic
1040126884 8:43747813-43747835 CCTGTTGTGGGGTGGGTGGATGG - Intergenic
1040806076 8:51397903-51397925 CCTGTTGTGGGGTGGGTGGAGGG - Intronic
1041518664 8:58730636-58730658 CCTGTTGTGGGGAGGGGGGAGGG + Intergenic
1042216717 8:66435447-66435469 CCAGCTGTGAAGATGGAGGAAGG - Intronic
1043130589 8:76456055-76456077 ACTGGCGTCTAGAGGGTGGAAGG - Intergenic
1043462282 8:80472489-80472511 CCTGCTGTGGGGTGGGGGGAGGG - Intergenic
1043937332 8:86156563-86156585 CATGCTGTGGAGGGGGTGGAGGG - Intergenic
1044068605 8:87727428-87727450 CCCCCTGTGTTGAGGGAGGAAGG + Intergenic
1045122202 8:99050182-99050204 CCTGTTGTGTGGTGGGGGGAGGG - Intronic
1045370238 8:101515622-101515644 CCCGCAGTGCAGAGGTTGGATGG + Intronic
1045585235 8:103527538-103527560 CCTGTTGTGGGGAGGGGGGATGG - Intronic
1045797040 8:106058337-106058359 CCTGCTGTGGGGTGGGGGGAGGG - Intergenic
1046698996 8:117378301-117378323 CCTGCTGTGGGGTGGGGGGAGGG + Intergenic
1051306985 9:15720837-15720859 CCTGTTGTGGGGTGGGTGGAGGG - Intronic
1053730351 9:41049131-41049153 CCTGGGGTGTAGGGAGTGGAGGG - Intergenic
1053754852 9:41295603-41295625 CCTGCTGTGTGGTGGGGGGAGGG - Intergenic
1053800875 9:41763946-41763968 GGTGCTGTGTGGAGGGTGGCGGG + Intergenic
1054144321 9:61550893-61550915 GGTGCTGTGTGGAGGGTGGCGGG - Intergenic
1054189306 9:61976096-61976118 GGTGCTGTGTGGAGGGTGGCGGG + Intergenic
1054260376 9:62859900-62859922 CCTGCTGTGTGGTGGGGGGAGGG - Intergenic
1054331396 9:63760092-63760114 CCTGCTGTATGGTGGGGGGAGGG + Intergenic
1054464009 9:65481852-65481874 GGTGCTGTGTGGAGGGTGGCGGG - Intergenic
1054649211 9:67612515-67612537 GGTGCTGTGTGGAGGGTGGCGGG - Intergenic
1054698151 9:68382930-68382952 CCTGGGGTGTAGGGAGTGGAGGG + Intronic
1055337855 9:75251341-75251363 CCTGCTGTTTGGAGGGTTCAAGG + Intergenic
1056066608 9:82941915-82941937 CCTGTTGTGGGGTGGGTGGAGGG + Intergenic
1056081305 9:83096779-83096801 CCTGTTGTGGGGTGGGTGGAGGG - Intergenic
1056483394 9:87029634-87029656 CCTGTTGTGGGGTGGGTGGAGGG + Intergenic
1058059434 9:100479142-100479164 CCTGTTGTGTAAAATGTGGATGG + Intronic
1058149278 9:101446350-101446372 TCTGCTGAGTAGAGGCTGAATGG + Intergenic
1058599937 9:106658382-106658404 GCTGCAGGGTGGAGGGTGGAGGG - Intergenic
1058961992 9:110000159-110000181 CCTGTTGTGTGGTGGGGGGAGGG - Intronic
1059530566 9:115031612-115031634 TTGGCTGTGTAGTGGGTGGATGG + Exonic
1060031273 9:120216952-120216974 GCTGCTGTGTGCATGGTGGATGG - Intergenic
1060226528 9:121794701-121794723 ACTGCTGTGTAGAGGTGGGAAGG - Intergenic
1060293115 9:122322693-122322715 TCTTCTGTGTAGATGGGGGAGGG - Exonic
1060603165 9:124891348-124891370 GCTGCTTTGAAGAGCGTGGATGG + Intronic
1060663032 9:125415602-125415624 ACTGCTGTGAAGAGGGTGCATGG - Intergenic
1061412949 9:130430998-130431020 ACTGCTGGGTAGAGGGGGGTGGG + Intronic
1061859638 9:133461245-133461267 CCAGGTGGGTAGAGGGTGGAGGG + Intronic
1062080169 9:134619532-134619554 CTTGTTGTGTGGGGGGTGGAGGG + Intergenic
1062254278 9:135613819-135613841 CCGGGTGTGGGGAGGGTGGAGGG - Intergenic
1202798772 9_KI270719v1_random:153022-153044 CCTGCTGTGTGGTGGGGGGAGGG + Intergenic
1185833974 X:3328540-3328562 ACTGCTTTGTAGAGAGTGAATGG + Intronic
1186397964 X:9229484-9229506 CCTGCTGTGGGGTGGGGGGATGG - Intergenic
1186674930 X:11806163-11806185 CCTGCTGTGTAGTGGGTGAAGGG + Intergenic
1186716293 X:12255375-12255397 CCTGAAGCGTATAGGGTGGAGGG + Intronic
1187665457 X:21604309-21604331 CCTGCTGTGGAGTGGGGGGAGGG + Intronic
1187813316 X:23204317-23204339 ACTGTTGTGTAGTGGGGGGAGGG + Intergenic
1187844235 X:23520272-23520294 CCTGTTGTGTAGTGGGGGGAGGG - Intergenic
1187887962 X:23907279-23907301 CCTGATGTGTGGATGGGGGAGGG - Intronic
1188484539 X:30668784-30668806 ACTGCTGTGTGGAGAGTAGATGG + Intronic
1188589066 X:31812410-31812432 CCTGCTGTGGGGTGGGGGGAGGG + Intronic
1188726717 X:33593279-33593301 ACTGCAGAGTGGAGGGTGGAAGG + Intergenic
1191614335 X:63151996-63152018 CCTGTTGTGGGGAGGGGGGAGGG + Intergenic
1191621961 X:63226931-63226953 CCTGTTGTGGGGAGGGGGGAGGG - Intergenic
1191994851 X:67082177-67082199 ACTGCTGTGGAGTGGGGGGAGGG + Intergenic
1192376993 X:70572844-70572866 CCTGCTGTGGGGTGGGGGGAGGG + Intronic
1192918489 X:75680666-75680688 CCTGTTGTGTGGTGGGGGGATGG - Intergenic
1193051047 X:77100228-77100250 CCTGTTGTGGAGTGGGGGGAGGG - Intergenic
1193566525 X:83083818-83083840 CCTGTTGTGGAGTGGGGGGAGGG - Intergenic
1195103289 X:101577288-101577310 CCTGTTGTGGGGAGGGGGGAGGG - Intergenic
1195171101 X:102269284-102269306 CCTGTTGTGTGGTGGGGGGACGG + Intergenic
1195187759 X:102417815-102417837 CCTGTTGTGTGGTGGGGGGACGG - Intronic
1195471642 X:105236993-105237015 CCTGCTGTGCGGTGGGGGGATGG - Intronic
1195522261 X:105844821-105844843 CCTGTTTTGTAGAGTGAGGAAGG - Intronic
1195818148 X:108910641-108910663 CCTGTTGTGGGGTGGGTGGAAGG + Intergenic
1196536467 X:116851104-116851126 CCTGCTGTGGGGTGGGGGGAGGG - Intergenic
1197079790 X:122398358-122398380 CCTGCTGTGGTGGGGGTGGCAGG - Intergenic
1198412999 X:136390670-136390692 CCTACAGTGCAAAGGGTGGAAGG + Intronic
1198814008 X:140567475-140567497 CCTGCTGTGGGGTGGGGGGAGGG - Intergenic
1199687977 X:150281222-150281244 CCTGATGTGTAGAGTGGGGCTGG + Intergenic
1200778273 Y:7190166-7190188 CCTGTTGTGGGGTGGGTGGAGGG - Intergenic
1200955708 Y:8943190-8943212 CCTGTTGTTTGGTGGGTGGAGGG - Intergenic
1201145392 Y:11062320-11062342 CCTGCTGGGGAGTGGGTGGCAGG - Intergenic
1201194401 Y:11477520-11477542 CCTGTTGTGGGGTGGGTGGAGGG - Intergenic
1201473227 Y:14355712-14355734 CAGACTGTGTAGAGGTTGGAAGG + Intergenic
1201916313 Y:19185276-19185298 CCTGTTGTGCAGTGGGGGGAAGG - Intergenic
1201941287 Y:19462919-19462941 ACTGCTGTGGAGTGGGGGGACGG + Intergenic
1202128808 Y:21591873-21591895 CATGCTGTCTAGATGTTGGAAGG + Intergenic