ID: 999768106

View in Genome Browser
Species Human (GRCh38)
Location 5:154755829-154755851
Sequence GGTGAGGAAGAAGCCGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 195}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999768097_999768106 11 Left 999768097 5:154755795-154755817 CCACGCTCTTGCAGGCCGAAGAG 0: 1
1: 0
2: 0
3: 6
4: 66
Right 999768106 5:154755829-154755851 GGTGAGGAAGAAGCCGCCGCCGG 0: 1
1: 0
2: 1
3: 15
4: 195
999768094_999768106 30 Left 999768094 5:154755776-154755798 CCGCTGCTGCCTGGGGGCGCCAC 0: 1
1: 0
2: 3
3: 30
4: 422
Right 999768106 5:154755829-154755851 GGTGAGGAAGAAGCCGCCGCCGG 0: 1
1: 0
2: 1
3: 15
4: 195
999768095_999768106 21 Left 999768095 5:154755785-154755807 CCTGGGGGCGCCACGCTCTTGCA 0: 1
1: 0
2: 0
3: 4
4: 61
Right 999768106 5:154755829-154755851 GGTGAGGAAGAAGCCGCCGCCGG 0: 1
1: 0
2: 1
3: 15
4: 195
999768104_999768106 -4 Left 999768104 5:154755810-154755832 CCGAAGAGCACGGGGGGCTGGTG 0: 1
1: 0
2: 1
3: 13
4: 145
Right 999768106 5:154755829-154755851 GGTGAGGAAGAAGCCGCCGCCGG 0: 1
1: 0
2: 1
3: 15
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999768106 Original CRISPR GGTGAGGAAGAAGCCGCCGC CGG Intronic
901632345 1:10654017-10654039 GGTGAAGGTGAAGCCGCAGCCGG + Exonic
902360431 1:15939500-15939522 GCAGAGGAAGAAGCTGCCGAAGG + Exonic
902920729 1:19664956-19664978 CGAGAGGAAGAGGCGGCCGCGGG - Intergenic
903362393 1:22784774-22784796 GGCCAGGTAGAAGCCGCTGCGGG - Exonic
904162473 1:28531894-28531916 GGAGAGGAAGAAGCCGGCCCTGG + Exonic
904696166 1:32332749-32332771 GGTGAGGAAGGAGCTGCCTGTGG + Exonic
907479666 1:54736800-54736822 GGTGAGAAAGACGCCCACGCTGG - Intronic
907479738 1:54737134-54737156 GGTGAGGAAGACGCCTGCACAGG - Intronic
907504100 1:54904797-54904819 GGTAAGGAGGAAGCTGACGCAGG + Intergenic
908605999 1:65797590-65797612 GGGGAAGAAGAAGCCTCCCCAGG + Intronic
910298315 1:85675782-85675804 GGTGATGTAGAAGCCACAGCAGG - Intronic
912876801 1:113368196-113368218 GCTGAGGTAGAAGCTGCCTCAGG + Intergenic
913979795 1:143498183-143498205 GGTGGGCAAGAAGCCGAGGCGGG - Intergenic
914074150 1:144323685-144323707 GGTGGGCAAGAAGCCGAGGCGGG - Intergenic
914105026 1:144642761-144642783 GGTGGGCAAGAAGCCGAGGCGGG + Intergenic
917289272 1:173455466-173455488 GGTGAAGAAGAAACCTCCGGGGG + Intergenic
920676941 1:208044629-208044651 GATGAGGAGGAGGCTGCCGCCGG + Exonic
920704839 1:208243551-208243573 GGCGCGGGAGAAGCCGCCACGGG + Intronic
922076732 1:222252786-222252808 GGTGAGGACCAGGCCGCAGCAGG + Intergenic
923836289 1:237614763-237614785 GGTGAGGAAGAAGCCAAGGGGGG + Exonic
1064596648 10:16952367-16952389 GGTGAGGATGTGGCCTCCGCAGG + Exonic
1065844249 10:29732007-29732029 GGAAAGAAAGAAGCCGCTGCAGG - Intronic
1066647198 10:37622024-37622046 GGAGTGGAAGAAGCCACCGAGGG - Intergenic
1067042657 10:42963151-42963173 GATGAGGAAGAAGTTGCCTCAGG + Intergenic
1067408671 10:46045846-46045868 GGAGGGGAAGAAGCTGCCACTGG - Intronic
1067427913 10:46223359-46223381 GGTGAGGAAGATGTTGCTGCTGG - Intergenic
1073025716 10:100485999-100486021 GGGGAGAAAAAAGCCGCTGCTGG - Intergenic
1074268076 10:111925598-111925620 GGTGAGGAAGAAGGAGCTGGGGG - Intergenic
1078445068 11:11397864-11397886 GATGAGCAAGAAGGGGCCGCTGG + Intronic
1078801099 11:14644452-14644474 GGTGAGGAAGAAGAAGGCACAGG - Exonic
1083233224 11:61336315-61336337 GCTCAGGAAGAAGCCACAGCCGG + Intronic
1085322584 11:75583829-75583851 GGTGGGGAAGGGGACGCCGCGGG + Intergenic
1089608700 11:119657258-119657280 GTGGAGGAAGAGGCCGCCCCAGG - Intronic
1089774459 11:120826697-120826719 TGTGAGCAAGAAGCCTCAGCTGG + Intronic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1096538438 12:52289798-52289820 GGTGGGGAGGAAGCCTCTGCAGG - Intronic
1096540341 12:52303566-52303588 GGTGGGGAGGAAGCCTCTGCAGG + Intronic
1101605916 12:106247737-106247759 CGTGGCGAAGAAGCCGCCGCCGG - Exonic
1102206092 12:111091747-111091769 GGTGAGGAAGGACCCTCCCCTGG - Intronic
1102493324 12:113302337-113302359 GGTGAGGAAGGATCCTCCTCTGG + Intronic
1103563460 12:121804247-121804269 GGGGAGGGAGAGGCCGCGGCCGG + Intronic
1103969095 12:124658582-124658604 GGTGAGGGAGTAGACCCCGCAGG + Intergenic
1104842179 12:131830470-131830492 TGTGAGCAGGAAGCCGCGGCAGG - Intronic
1106546975 13:30739101-30739123 GTTCAGGAAGAAGCAGCCGGTGG - Intronic
1106618318 13:31350776-31350798 GATGAGGAAGCAGCCGCCTGCGG + Intergenic
1107016917 13:35714824-35714846 GGAGAGGAAGCAGCTGCAGCTGG + Intergenic
1113904373 13:113812556-113812578 GGTGAGGGAGAAGCCGCGGAAGG - Exonic
1115591869 14:34873717-34873739 AGTGAGGAAGAAGTCGCGGCTGG - Intronic
1121325002 14:93014736-93014758 GTGGAGGAAGAAGCAGCTGCAGG - Intronic
1121544422 14:94753003-94753025 TGTGAGGAAGAGGCCACGGCAGG + Intergenic
1122600312 14:102918048-102918070 GGGGAGGAAGGAGCCGCCACTGG - Intergenic
1123048541 14:105529929-105529951 TGAGATGAAGAAGCGGCCGCGGG - Exonic
1123108821 14:105855751-105855773 GTTGCCGAAGAAGCCGTCGCGGG + Intergenic
1202936678 14_KI270725v1_random:94143-94165 GGGGAGGAAAAAGCCGTGGCGGG + Intergenic
1123396523 15:19943591-19943613 GGCGGGTAAGAAGCCGCGGCAGG - Intergenic
1125021066 15:34987714-34987736 AGTGGGGCAGAAGCAGCCGCCGG - Intronic
1125405777 15:39351515-39351537 GGTGAAGAAGAAGTGGCCTCTGG + Intergenic
1125608708 15:40956873-40956895 TGTTAGGAAGAGGCAGCCGCTGG - Intergenic
1125727059 15:41873554-41873576 GGTGGAGGAGAAGCGGCCGCTGG - Exonic
1128779892 15:70352353-70352375 GGGGAGGAAGCAGCCCCCACAGG + Intergenic
1131056539 15:89378496-89378518 GGTGTCCAAGAAGCCGCCTCCGG - Intergenic
1131152778 15:90057310-90057332 GGTGAGGAAGAAGGCACCTGGGG + Intronic
1132394523 15:101463069-101463091 GGTGAGGAAGAAGTGTCCGCAGG - Intronic
1132394669 15:101464022-101464044 GGTGAGGAAGAAGTGTCCGCAGG + Intronic
1132464817 16:72551-72573 GGGGAGGAGGCTGCCGCCGCTGG + Exonic
1132724980 16:1334516-1334538 GGGGAGGAAGAAGGCGCCTCGGG + Exonic
1132937637 16:2489578-2489600 GGTGAGAAAGAAGCCGCACTGGG + Intronic
1138461079 16:57148129-57148151 GCTGAGGAAGGAGCTGACGCAGG - Exonic
1141554793 16:84829877-84829899 GATGAGGAAGGGGCTGCCGCAGG - Intronic
1141701316 16:85643493-85643515 GGTGAGGAAGAAAGAGGCGCGGG - Intronic
1142715927 17:1746970-1746992 GGTGAGAAAGGACCCGCAGCCGG + Intronic
1145846286 17:28041846-28041868 GCTGAGGAGAAAGCGGCCGCGGG + Intronic
1147441119 17:40447829-40447851 GGTGATGAAGAAGCTGATGCTGG + Intronic
1151343970 17:73490245-73490267 GGTGATCAAGAAGCCGGGGCAGG + Intronic
1151433991 17:74082888-74082910 GGTGAGGAAGAAGACCCAGGAGG + Intergenic
1151575664 17:74951552-74951574 TGTGAGGATGAAGCCGACGAGGG - Exonic
1152214283 17:79023608-79023630 GGTTAGGAAGGAGCCCCTGCCGG - Intronic
1152280058 17:79379922-79379944 GGTGCGGGAGAGGCCGCGGCAGG - Intronic
1152342410 17:79732539-79732561 GGTGAGGAGGGAGCCTCTGCTGG - Intronic
1152396605 17:80036764-80036786 GGCGAGGCAGGAGCCGACGCGGG - Intronic
1152400990 17:80066018-80066040 GGGGAGGAAGAGGCCTCCTCTGG + Intronic
1152646039 17:81468992-81469014 GGTGAGGAGGGAACCGCCTCTGG + Intergenic
1152818661 17:82424351-82424373 GGTTAGGAAGAAGTGGCTGCTGG - Intronic
1155972281 18:32093043-32093065 GCTGAGGAAAAGGCCGCCCCGGG - Intronic
1157354188 18:46917772-46917794 GGGGAGGAAGAAGAGGCGGCCGG + Intronic
1157496145 18:48158858-48158880 GGTGAGCATGAAGCCGCTGGGGG + Intronic
1160454881 18:78993094-78993116 GTTGGGGAAGATGACGCCGCTGG - Exonic
1160662933 19:309398-309420 GGTGGGAAAGCAGGCGCCGCGGG - Intronic
1161625200 19:5322457-5322479 TGGGAGGAAGAAGCAGCCGCGGG + Intronic
1161743415 19:6039889-6039911 GGTGAGTAAGAGGCAGCCGGAGG - Intronic
1161795102 19:6381812-6381834 GGCCAAGAAGAAGGCGCCGCTGG - Exonic
1162597365 19:11639783-11639805 GGTGACAGAGAAGACGCCGCGGG - Intergenic
1163138613 19:15331858-15331880 GAGGAGGAAGCGGCCGCCGCGGG - Intronic
1164533134 19:29063164-29063186 GGGCAGGAAGAAGCCCCTGCAGG - Intergenic
1164681695 19:30138539-30138561 GCTGAGGACGAAGCCGCGGAGGG + Intergenic
1165682640 19:37790650-37790672 CCTGAGGAAGAAGGCGGCGCGGG + Intronic
1165695105 19:37894968-37894990 GGTGATGGAGGAGCCGCTGCTGG + Exonic
1166222560 19:41375135-41375157 GGTGAGGAGGAAGCAGAGGCAGG - Intronic
1166378645 19:42343356-42343378 GGTGAGGTTGAAGCAGCCACCGG + Intronic
1167503920 19:49861641-49861663 GGTGAAGAGGAAGCAGCGGCAGG + Exonic
1167538303 19:50069444-50069466 GGTGAGGAAGGACCCTCCCCTGG + Intergenic
1168489350 19:56795313-56795335 CGTGAGGAAGACTCCGCGGCGGG - Intronic
925851527 2:8086743-8086765 GGTGAGGAAGAGGCAGCCATGGG + Intergenic
926243530 2:11105469-11105491 GGTGTGGGAGAGGCAGCCGCCGG + Intergenic
926433767 2:12817513-12817535 GGTGAGGAAGGATCCCCCACAGG + Intergenic
928904518 2:36355911-36355933 GGAGAGGGAGGAGGCGCCGCCGG + Exonic
932099957 2:68889690-68889712 GGAGAGGAAGTGGCTGCCGCAGG - Intergenic
932615543 2:73228944-73228966 GGAGAGGAAGGAGCAGCCCCTGG + Exonic
934304519 2:91810140-91810162 GGGGAGCAAAAAGCCGCGGCGGG - Intergenic
934328738 2:92042610-92042632 GGGGAGCAAAAAGCCGCGGCGGG + Intergenic
935274467 2:101464040-101464062 GCTGAGGAAGAACCAGCCACTGG + Intronic
937324532 2:120982639-120982661 GGTGGGGAGGAAGCAGCAGCCGG + Intronic
943185115 2:184598106-184598128 CTTGAGAAAGAAGCCGCTGCTGG + Intergenic
947955847 2:234190055-234190077 GGTCAGGAAGAAGCAGCGGAAGG - Intergenic
948698698 2:239747386-239747408 GCTGGGGAAGAAGCGGCCACAGG - Intergenic
1170439713 20:16366566-16366588 AGTGAGGAAGAAGACACTGCAGG + Intronic
1171266799 20:23777565-23777587 GGAGAGGGAGCAGCAGCCGCGGG + Intergenic
1171292979 20:23993316-23993338 GGTGAGGAAAGGGCTGCCGCTGG - Intergenic
1172093241 20:32448052-32448074 GGTGAGGAAGAGGCGGCCTTGGG + Intronic
1172147054 20:32763964-32763986 GGTGAACAAGAAGCCCCAGCAGG - Intronic
1172664666 20:36590933-36590955 TGTCTGGGAGAAGCCGCCGCCGG - Exonic
1173940529 20:46907404-46907426 GGTGAGGAAGCAGCAGCCTGTGG + Intronic
1174043265 20:47714875-47714897 GGTGAGGAAGCAGCCCATGCAGG - Intronic
1174176975 20:48651402-48651424 GGTGAGGCCGAAGCAGCCGCGGG + Exonic
1175374985 20:58517991-58518013 GGTGAGGATGCAGCAGGCGCAGG - Intergenic
1175637574 20:60598618-60598640 GCTGGGGAAGAAGCAGGCGCAGG - Intergenic
1175910430 20:62402732-62402754 GGTGAGGCTGCAGCCCCCGCAGG - Intronic
1176586846 21:8595591-8595613 GGGGACGAAAAAGCCGCGGCGGG - Intergenic
1179925858 21:44533711-44533733 GGTGAGGGAGAAGACGCCTGCGG + Exonic
1180054909 21:45352710-45352732 GGTGAGCACAGAGCCGCCGCAGG - Intergenic
1180269460 22:10571782-10571804 GGGGAGCAAAAAGCCGCAGCGGG - Intergenic
1180269675 22:10572571-10572593 GGGGACGAAAAAGCCGCGGCGGG - Intergenic
1181399010 22:22639915-22639937 GGTGAGGAAAGGGCTGCCGCTGG + Intergenic
1181419122 22:22785712-22785734 TTGGAGGAAGAAGCCGCCTCTGG + Intronic
1183281223 22:36933696-36933718 GGTGAGAGAGAAGCCGCAGCAGG + Intronic
1183993785 22:41618000-41618022 GATGAGGAAGAAGTAGCCACAGG - Intronic
1184233623 22:43171508-43171530 GGTGAGGAGTAAGCCCCGGCTGG + Intronic
1185125335 22:49007365-49007387 GGGGAGCAAGCAGCCCCCGCAGG + Intergenic
951724720 3:25744518-25744540 GATGATGACGAAGCCCCCGCTGG - Intronic
952871678 3:37906314-37906336 GGTGAGGAAGGAGAGGCTGCTGG - Intronic
953752049 3:45616479-45616501 GGTGAGGAAGAAGGGGTCGGGGG - Intronic
953886987 3:46719702-46719724 GGGGAGGGAGAAGCAGCCTCTGG + Exonic
954880798 3:53834739-53834761 GGTGAGGAAGAAAGTGCTGCTGG - Intronic
957376768 3:79368685-79368707 GGAGAGGAAGGAGCAGCAGCAGG - Intronic
959575397 3:107927898-107927920 GGCGGGGAAGAGGACGCCGCCGG + Intergenic
963044887 3:141095107-141095129 GGTGGGGAAGAGGCCGAGGCAGG + Intronic
967392653 3:188972515-188972537 GGGGAGGAAGCAGCCCCAGCTGG - Intronic
968558262 4:1261426-1261448 GGTGAGGAAGAAGCCTGGGGTGG + Intergenic
968836889 4:2971745-2971767 TGTGAGGAAGAATCTGTCGCAGG + Intronic
969070285 4:4531574-4531596 GCTGAGTAAGAAGCCCCCACTGG + Intronic
969336827 4:6515846-6515868 GGTGAGGAAGAATCCTCCCCTGG - Intronic
973330790 4:48908423-48908445 CGTGAGGAGGAAGCGGCCACAGG - Intergenic
976211974 4:82680814-82680836 GGAGAAGAAGAAGCCCCGGCGGG + Exonic
978197913 4:105991899-105991921 AGTGAGGGAGAAGCAGCTGCAGG + Intronic
982161850 4:152578343-152578365 GGGGAGGAAAAAGCCACTGCAGG - Intergenic
984981884 4:185289976-185289998 GGTGAGGAAGGACCTGCCTCAGG + Intronic
985653858 5:1119885-1119907 GGGGAGGCAGAAGCAGCCACAGG - Intergenic
986132175 5:4942106-4942128 GGAGAAGAAGAAACGGCCGCAGG - Intergenic
986972424 5:13352710-13352732 TGGGAGGAAGAAGCAGCAGCAGG - Intergenic
990874633 5:60470358-60470380 GCTGAGGAAGAAGTTGCAGCAGG + Intronic
991967637 5:72108161-72108183 GGTGAGGATGAATCCCACGCGGG - Intronic
992104212 5:73436832-73436854 GGTGAGGAAGGGGCGGCCGCGGG - Intergenic
997500856 5:134372003-134372025 GGAGAGGAACAAGCTCCCGCAGG - Intronic
999768106 5:154755829-154755851 GGTGAGGAAGAAGCCGCCGCCGG + Intronic
1001995539 5:176154510-176154532 GGTAAGGAAGACGAAGCCGCAGG + Intergenic
1003307992 6:4946387-4946409 GGTGAGGAAAATGCCCCCACTGG - Intronic
1004210091 6:13631556-13631578 GGTCAGGAAGAAACAGCGGCAGG + Intronic
1004308608 6:14523637-14523659 GGAGAGGGAGAAGGGGCCGCTGG - Intergenic
1005048531 6:21664500-21664522 GGAGATAAAGAAGCGGCCGCCGG - Intergenic
1006167768 6:32075250-32075272 AGTGAGGTAGAAGCCACTGCGGG - Intronic
1006321094 6:33320010-33320032 GAAGAGGAAGAAGCAGCAGCAGG - Exonic
1018273321 6:162103833-162103855 GGTGAGGAAGAGGAGGCAGCTGG - Intronic
1019074413 6:169376553-169376575 GGTGAGGAGGCAGCAGCCACGGG - Intergenic
1019313260 7:373021-373043 GGTGAGGAGGAAGCTGGGGCAGG - Intergenic
1019712208 7:2522923-2522945 GGGGAGGAAAAAGGCGCTGCTGG - Intronic
1019940098 7:4282845-4282867 GGTGGGAAAGAAGCAGCTGCTGG + Intergenic
1020212437 7:6166678-6166700 GGTGAGGAGGAACCAGCTGCAGG + Intronic
1023528535 7:41130121-41130143 GGACAGGAAGAAGCCGCATCGGG + Intergenic
1024026124 7:45411232-45411254 GGTGAGGAAGGAACCACCCCTGG - Intergenic
1024048182 7:45599523-45599545 GCTGAGGAAGATGCCGGAGCTGG + Intronic
1024404189 7:48959182-48959204 GGAGAAGAAGAAGCTGCTGCTGG - Intergenic
1025481683 7:60991909-60991931 GGCGGGGAAAAAGCCGCGGCCGG - Intergenic
1025561688 7:62379550-62379572 GGGGAGCAAAAAGCCGCCGCGGG - Intergenic
1032239522 7:130149927-130149949 GGTGCAGAAGAGGCAGCCGCAGG + Intergenic
1033394170 7:140957568-140957590 GCTGAGGGAGAAGCTGCAGCAGG + Intergenic
1034263976 7:149772748-149772770 GGGGAGGAAGAAGCGGGCGCTGG - Intronic
1035638365 8:1163793-1163815 GGTGAGGAAGCAGCTGCCCGCGG + Intergenic
1041896148 8:62926661-62926683 GAGGAGGAAAAAGCCGCCGGCGG - Intronic
1042962174 8:74315412-74315434 GTTGAGCACGAAACCGCCGCGGG + Exonic
1048329796 8:133463826-133463848 GGTGAGAAAGGGGCAGCCGCGGG - Intronic
1049870732 8:144973414-144973436 GGTGATGAAGAAGCCTTGGCAGG + Intergenic
1053312276 9:37027365-37027387 GGCGAGGAAGAGTCCGTCGCTGG - Intronic
1053501495 9:38599294-38599316 GGTGAGGAAGCAGACGCACCTGG - Intergenic
1053697095 9:40649668-40649690 GGGGGGCAAAAAGCCGCCGCGGG + Intergenic
1054308347 9:63448902-63448924 GGGGGGCAAAAAGCCGCCGCGGG + Intergenic
1054407079 9:64772888-64772910 GGGGTGCAAAAAGCCGCCGCGGG + Intergenic
1054440698 9:65258335-65258357 GGGGGGCAAAAAGCCGCCGCGGG + Intergenic
1054489704 9:65763574-65763596 GGGGTGCAAAAAGCCGCCGCGGG - Intergenic
1057192591 9:93095968-93095990 GGAGAGGCGGAAGCCGACGCCGG + Intergenic
1058678965 9:107425158-107425180 GGGAGGGAAGAAGCCTCCGCCGG - Intergenic
1060243469 9:121925064-121925086 GGAGAGGAAGAAGCAGACACAGG + Intronic
1060480130 9:124012739-124012761 GGTGAGAAGGGAGCCGCCCCGGG - Intronic
1060818080 9:126645873-126645895 GGTGGGGGAGAAGCCGCTGAGGG + Intronic
1060994766 9:127869680-127869702 TGTAAGGTAGAAGCAGCCGCTGG - Intronic
1061664950 9:132155213-132155235 GTTGTGGAAGGAGCCGCAGCTGG - Intergenic
1061899666 9:133666458-133666480 GGGGAGGAAGAGGCCTCAGCAGG - Intronic
1202779546 9_KI270717v1_random:23328-23350 GGGGTGCAAAAAGCCGCCGCGGG + Intergenic
1203616807 Un_KI270749v1:73277-73299 CGTGGGGAACAAGCCGCGGCGGG - Intergenic
1203616843 Un_KI270749v1:73430-73452 GGGGGGCAAGAAGCCGCGGCGGG - Intergenic
1192292847 X:69815629-69815651 GGTGTGGCTGAAGCCCCCGCAGG - Intronic
1192880121 X:75274457-75274479 GTTGAGGCTGGAGCCGCCGCAGG - Exonic
1199659672 X:150036382-150036404 GGTGAGGAAGAACTCTCTGCTGG - Intergenic