ID: 999768170

View in Genome Browser
Species Human (GRCh38)
Location 5:154756040-154756062
Sequence GGCGGCGGCGAGCCAGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 629
Summary {0: 1, 1: 1, 2: 5, 3: 69, 4: 553}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999768166_999768170 -3 Left 999768166 5:154756020-154756042 CCATCAGCGACGGGGAGGAGGGC 0: 1
1: 0
2: 1
3: 8
4: 117
Right 999768170 5:154756040-154756062 GGCGGCGGCGAGCCAGGCGCTGG 0: 1
1: 1
2: 5
3: 69
4: 553
999768163_999768170 1 Left 999768163 5:154756016-154756038 CCGGCCATCAGCGACGGGGAGGA 0: 1
1: 0
2: 0
3: 4
4: 84
Right 999768170 5:154756040-154756062 GGCGGCGGCGAGCCAGGCGCTGG 0: 1
1: 1
2: 5
3: 69
4: 553
999768157_999768170 9 Left 999768157 5:154756008-154756030 CCGAAGGCCCGGCCATCAGCGAC 0: 1
1: 0
2: 0
3: 4
4: 67
Right 999768170 5:154756040-154756062 GGCGGCGGCGAGCCAGGCGCTGG 0: 1
1: 1
2: 5
3: 69
4: 553
999768156_999768170 15 Left 999768156 5:154756002-154756024 CCGGCGCCGAAGGCCCGGCCATC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 999768170 5:154756040-154756062 GGCGGCGGCGAGCCAGGCGCTGG 0: 1
1: 1
2: 5
3: 69
4: 553
999768161_999768170 2 Left 999768161 5:154756015-154756037 CCCGGCCATCAGCGACGGGGAGG 0: 1
1: 0
2: 0
3: 5
4: 134
Right 999768170 5:154756040-154756062 GGCGGCGGCGAGCCAGGCGCTGG 0: 1
1: 1
2: 5
3: 69
4: 553
999768155_999768170 16 Left 999768155 5:154756001-154756023 CCCGGCGCCGAAGGCCCGGCCAT 0: 1
1: 0
2: 0
3: 0
4: 77
Right 999768170 5:154756040-154756062 GGCGGCGGCGAGCCAGGCGCTGG 0: 1
1: 1
2: 5
3: 69
4: 553
999768152_999768170 28 Left 999768152 5:154755989-154756011 CCGCTGCAGCTGCCCGGCGCCGA 0: 1
1: 0
2: 0
3: 11
4: 176
Right 999768170 5:154756040-154756062 GGCGGCGGCGAGCCAGGCGCTGG 0: 1
1: 1
2: 5
3: 69
4: 553

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999768170 Original CRISPR GGCGGCGGCGAGCCAGGCGC TGG Intronic
900168472 1:1254522-1254544 GGCGGCCGCGAGCGGGGCGGGGG - Intronic
900349672 1:2228503-2228525 GGCGGCGGCGGGCGCGGCGCGGG + Intergenic
900604655 1:3518566-3518588 GGCTGCGCCGAGGCAGGGGCTGG + Intronic
900610092 1:3541050-3541072 GGCGGGGTGGGGCCAGGCGCAGG + Intronic
900645254 1:3706113-3706135 GGCGGAGGCGGGCCGGGGGCGGG - Intronic
901433991 1:9235075-9235097 GGCGGCGGCGGGGCCGGCGGGGG - Intronic
901660305 1:10794893-10794915 GGCGGGGGCTGGCCGGGCGCGGG - Intronic
901730094 1:11273124-11273146 GGCGGGGCCGAGCCAGAGGCGGG - Intergenic
902169583 1:14599121-14599143 GGCGGCGGCGGCCCCGGCCCGGG + Exonic
902234284 1:15047797-15047819 GGAGGTGGGGAGCCAGGCCCGGG + Intronic
902768563 1:18632454-18632476 GGCGGCGGCGAACCGGGTCCTGG + Intronic
902823232 1:18956220-18956242 GGCGGCGGCGGGGCAGGGCCGGG - Exonic
903153316 1:21428306-21428328 GGCGGCGGCGCGCCAGCGGCAGG + Intergenic
903468496 1:23568530-23568552 GGAGGCGGCGTGCAGGGCGCTGG - Intergenic
903580055 1:24364203-24364225 GGGGGTGGCGAGACAGGCGTGGG - Exonic
903907292 1:26696171-26696193 GGCGGCGGCGGCCGAGGCGCCGG - Exonic
904236733 1:29121735-29121757 GCCGGCGGCGGCCCAGGCGGCGG + Exonic
904586567 1:31584124-31584146 GGCAGCGGGGAGGCAGGGGCTGG + Intronic
904618934 1:31764080-31764102 GGCGGCGCCGGGCCGGGCGCGGG + Intronic
904822749 1:33256237-33256259 GGCGGGGGCGGGCCGCGCGCTGG - Intergenic
905066914 1:35192319-35192341 GGCGGCGGGGAGCCCCGCGGGGG - Exonic
905257340 1:36693321-36693343 GAGGGTGCCGAGCCAGGCGCCGG - Intergenic
905886862 1:41496362-41496384 GGCGGCGGCGCGCTACGTGCCGG + Intergenic
906078414 1:43068412-43068434 GGCGGGGGCGGGCTGGGCGCTGG + Intergenic
906102667 1:43273111-43273133 GGCGGCGGCCAGCCCGGCCAGGG - Exonic
906214506 1:44030978-44031000 GGCGGGGGGGCGCCAGACGCCGG - Intronic
906319722 1:44808521-44808543 GGCGGCGGCGAAAGAGGCCCTGG - Exonic
907189057 1:52633466-52633488 GGTGGCGGCGGGCTGGGCGCGGG + Exonic
907341576 1:53739263-53739285 GGCCGCGGCCAGCCAGTGGCTGG - Intergenic
907422455 1:54356552-54356574 GGCGGCCGGGAGCTAGGCGGCGG + Intronic
907450310 1:54542137-54542159 GCGGGCGGGGAGCCTGGCGCCGG + Intergenic
907486513 1:54781704-54781726 GGCGGCGCTGAACCAGGCGCTGG - Exonic
907978782 1:59460249-59460271 GGACCCGCCGAGCCAGGCGCAGG - Intronic
908293190 1:62688196-62688218 GGCGGCGGCGCGCCCCACGCCGG + Intronic
908355703 1:63323404-63323426 AGCGGCGGCGGGCCTGGCGCGGG + Exonic
908501206 1:64745194-64745216 GGCGGCGGCGAGGGGGGCGCGGG + Exonic
908584180 1:65550529-65550551 GGCGGCAGCGAGGCTGGGGCAGG - Intronic
908714298 1:67053778-67053800 GGCGGCGGCGGCCCAGGCCGCGG - Intronic
910657406 1:89632986-89633008 GGCGGTGGCGACCCCGGGGCCGG + Intergenic
912270139 1:108200274-108200296 GGCTGCGGCGCGCAGGGCGCAGG + Exonic
912481483 1:109985014-109985036 GGGGGCGGCGGGTCAGCCGCTGG + Exonic
912993487 1:114511115-114511137 GGCGGCGGCGACGCGGGCGGCGG - Exonic
913129736 1:115828714-115828736 GGCGGCGGCGGGCTGGGGGCGGG + Intergenic
914255333 1:145957782-145957804 GGAGGCGGCGGGGCAGGCGGGGG + Exonic
914293606 1:146298065-146298087 GGCGAGGGCGAGTCGGGCGCAGG - Intergenic
914554650 1:148748848-148748870 GGCGAGGGCGAGTCGGGCGCAGG - Intergenic
915325269 1:155078768-155078790 GTCGGGGGCGCGCCAGGGGCGGG + Intergenic
915913798 1:159929659-159929681 GGCGGCGGGCAGCCCTGCGCCGG + Exonic
916816099 1:168354448-168354470 GGCGGCAGCGAGGCTGGGGCAGG - Intergenic
916890099 1:169106089-169106111 GGCGGCGGTGAGGGACGCGCAGG - Intronic
918064417 1:181089596-181089618 AGCGGGGTCGAGCCGGGCGCCGG - Exonic
919809397 1:201399330-201399352 GGCGGCGGCCGGCGGGGCGCGGG - Exonic
922440657 1:225653055-225653077 GGCGGCGGCGCGGCGAGCGCGGG - Exonic
922693070 1:227710784-227710806 GGGGGCGGCTGGCCAGGCGGGGG + Intergenic
922958614 1:229626001-229626023 GGCGGCGGGGCGCGGGGCGCGGG - Exonic
923400768 1:233614061-233614083 GGCGGGCGGGAGCCAGGCCCGGG + Exonic
923986436 1:239387236-239387258 GGCGCCCGCCACCCAGGCGCTGG + Intronic
1062924230 10:1302431-1302453 GGCGGCAGCGAGCCTGGGGGAGG + Intronic
1064011849 10:11742282-11742304 GGGAGCGGCGAGCCGGGGGCGGG + Intergenic
1065025097 10:21534098-21534120 GGCGGCGGCGAGCGGCGCGGGGG + Intergenic
1065101988 10:22340677-22340699 CGCGGGGGCGAGCCCGGAGCCGG - Intergenic
1065177771 10:23095684-23095706 GGCGGCGGCGGGCCCGGCACCGG + Exonic
1065343009 10:24723760-24723782 GGCGGCCGAGAGCCCGGGGCCGG - Intergenic
1065573965 10:27100229-27100251 GGCGGGGGCGAGCCGGGGGAGGG - Exonic
1066370405 10:34814823-34814845 GGCGGCGGCGGGGACGGCGCCGG - Intronic
1066464200 10:35639448-35639470 GGCGGCGGGGGGCCGGGCGGCGG - Exonic
1066464422 10:35640387-35640409 AGCGGTGGCGCGCCGGGCGCGGG - Exonic
1069564002 10:69451359-69451381 GGAGGGGGCGGGCCAGGGGCGGG - Intergenic
1071086633 10:81874549-81874571 CGCCGCCGCGAGCCAGGGGCTGG - Intergenic
1071532434 10:86400481-86400503 GGCGGCGGCGAGCCGAGACCAGG - Intergenic
1071847575 10:89535832-89535854 GGCGCCGGCGAGGCTGGGGCCGG + Intronic
1071912426 10:90251030-90251052 GGCGGCAGCGAGCCTGGGGGAGG + Intergenic
1072107884 10:92291284-92291306 GGCGGCGGAGAGCGAGGAGGAGG - Exonic
1074008942 10:109457049-109457071 GGCCGCGGCGGGGCAGGCGTAGG + Intergenic
1074784560 10:116827550-116827572 AGTGGCGGTGAGCCTGGCGCTGG - Intergenic
1076084166 10:127610617-127610639 GACGACGGGGAGCCAGGAGCTGG - Intergenic
1076146456 10:128126177-128126199 GGCGGAGGTGAGCGCGGCGCCGG - Exonic
1076373129 10:129967537-129967559 GGGAGCGGCGTGCCGGGCGCAGG + Intergenic
1076373895 10:129971324-129971346 CGTGGCGGCGGGCCTGGCGCGGG + Intergenic
1076707135 10:132308105-132308127 GGCGGGGCCGAGCCGGGGGCGGG + Intronic
1076857612 10:133124891-133124913 GGCGGCGGCGAGAAAAGCGGCGG + Intronic
1077062665 11:624765-624787 GGCGGCGGGGAGCCAGGGGCTGG - Intronic
1077376788 11:2209010-2209032 GGCGGCGGCAGGGCAGGCCCAGG + Intergenic
1077501022 11:2909752-2909774 GGCGGGGCCGACCCAGCCGCGGG - Intronic
1078168482 11:8910978-8911000 GGAGGCGGGGCGCCGGGCGCTGG - Intergenic
1078316052 11:10294102-10294124 GGCGGCGGCGAGGGCGGCGACGG - Exonic
1078659821 11:13277847-13277869 GGCGGCGGTGAGTCCGGCGCGGG - Exonic
1079035220 11:17014491-17014513 GGCGCCGCCGGGCCACGCGCAGG - Intergenic
1079451198 11:20601246-20601268 GGCGGCGGGGCGGCAGCCGCGGG - Exonic
1080902636 11:36510273-36510295 GGCTGCGGGGAGCGAGGGGCAGG + Intergenic
1081152741 11:39652219-39652241 GGCGGGGCTGAGCCAGGCCCAGG - Intergenic
1081861024 11:46333352-46333374 TGCGGCGGCGATGCCGGCGCGGG + Intronic
1082162528 11:48900691-48900713 GGGGGTGGGGAGGCAGGCGCAGG - Intergenic
1082238894 11:49852045-49852067 GGGGGTGGGGAGGCAGGCGCAGG + Intergenic
1082657746 11:55873110-55873132 GGGGGTGGGGAGGCAGGCGCAGG - Intergenic
1082784897 11:57311397-57311419 GGGTGCGGCCAGCCGGGCGCAGG + Intronic
1082838445 11:57668443-57668465 GGCGGCTGGGCGCCAGGCACCGG - Intronic
1083301809 11:61743601-61743623 GGCGGCGGCCCGCCAGGACCCGG + Exonic
1083617975 11:64035821-64035843 GGCGGCGGCGAGCAGGGCGCGGG - Intronic
1084069939 11:66727792-66727814 GCCGGCGCCGGGCCAGGTGCTGG - Intronic
1084102476 11:66958625-66958647 GGCGGTGGTGCGCCAGGGGCGGG - Intergenic
1084264242 11:67996804-67996826 AGGGGCGGCCAGCCAGGCCCAGG + Intronic
1084891664 11:72239867-72239889 GGGGGCGGCGGGCCTGGCGCGGG - Exonic
1085641578 11:78196323-78196345 GGAGGCGGCGCGGCAGCCGCTGG + Exonic
1086697674 11:89864108-89864130 GGGGGTGGGGAGGCAGGCGCAGG - Intergenic
1088279399 11:108121435-108121457 GGCGGGGCGGAGCCTGGCGCTGG - Intergenic
1090832412 11:130428475-130428497 GGCGGCGGCGCGGGAGGAGCGGG - Exonic
1092294808 12:7189664-7189686 GGGGGCGGGGAGCCAGGGGGCGG - Intronic
1094041166 12:26122816-26122838 CTCGGCGGCGAGCTCGGCGCTGG + Exonic
1095773634 12:45990084-45990106 GGCGGCGGCGGCCCAGGGCCGGG + Intronic
1096024737 12:48350902-48350924 GACGGCGGCCCGGCAGGCGCGGG + Intronic
1096435975 12:51591331-51591353 GGCGGCGGCGAGGGAGGCAGCGG - Exonic
1097046295 12:56189630-56189652 GGCGGCGGAGCTCCAGGCGCGGG + Intergenic
1097062996 12:56300021-56300043 GCTGGCGGCCAGCCAAGCGCAGG + Intronic
1097107676 12:56634972-56634994 GGCGGCGGCGGCAGAGGCGCAGG + Intronic
1097222608 12:57459944-57459966 AGCGGCGGCGCGCCAGCGGCTGG + Intergenic
1097237007 12:57547064-57547086 GGCGGCGGCGAGACGGGCTGGGG + Exonic
1097305008 12:58059258-58059280 GGCGGCAGCGAGACTGGCGGAGG - Intergenic
1100309155 12:93378218-93378240 GGCGAGGGCGAGTCGGGCGCAGG - Exonic
1100565490 12:95790461-95790483 GGCAGCTGGGAGCCAGGGGCCGG + Exonic
1101254180 12:102961344-102961366 GCAGGCGGCGAGCGAGGAGCCGG - Intergenic
1102244570 12:111347491-111347513 GACGGCGGTGAGCCTGGGGCTGG - Intronic
1102300335 12:111766859-111766881 GGCGGGGGCGGGCCGGGGGCGGG - Intronic
1102501875 12:113358714-113358736 GGCGGGGGCGATCCCAGCGCCGG + Exonic
1102518484 12:113465341-113465363 GGAGGCGGCGCGCACGGCGCGGG - Intronic
1103203609 12:119110534-119110556 GGCGGCAGCGAGGCTGGGGCAGG - Intronic
1103621615 12:122190415-122190437 GGCGGGGCACAGCCAGGCGCAGG - Intronic
1103649682 12:122422771-122422793 GGCGGCGCGGGGCCGGGCGCGGG - Intergenic
1103944260 12:124517550-124517572 GGCAGGGGAGAGCCAGGTGCAGG - Intronic
1104718357 12:131031097-131031119 GGCCCCGGGGAGCCAGGGGCTGG + Intronic
1104718960 12:131034041-131034063 GGCGGCTGGGAGGCTGGCGCTGG - Intronic
1104929262 12:132329495-132329517 GGGGGCGGCGGGGAAGGCGCGGG + Intergenic
1104961128 12:132489307-132489329 TGCGGTTGCGAGGCAGGCGCGGG - Intergenic
1104961550 12:132490509-132490531 GCCTGCTGCGAGCCAGGCGCGGG + Exonic
1105745617 13:23375108-23375130 GGCGGCCGCGAGGTAGGCGGTGG - Exonic
1105943662 13:25171696-25171718 GGCGGCGGCGAGCGCGGCTCAGG - Exonic
1106447581 13:29850345-29850367 GGCGGCGGCGGGGAAGGCGGAGG - Exonic
1106517144 13:30465324-30465346 CGCCGCAGCGAGCCGGGCGCTGG - Intronic
1106560154 13:30839706-30839728 TGGGGCGGCTAGCCAGGCGGGGG + Intergenic
1107304770 13:39006439-39006461 GGCGGCAGCGAGCCTGGGGGAGG - Intergenic
1107307376 13:39037683-39037705 GGCGGCGGGGAGGGAGGCGCCGG + Exonic
1110705916 13:78602133-78602155 GGCGGCGGCGGCCCGGGCGGCGG - Exonic
1110705945 13:78602190-78602212 GGCGGCGGCGGCCCGGGCGGCGG - Exonic
1111672466 13:91348068-91348090 GGCGGCGGCGTGGCCGGGGCGGG + Intergenic
1112271947 13:97976603-97976625 GGCGGGGGCGGGCCCAGCGCGGG - Intronic
1112507855 13:99985575-99985597 GGCGGCGGCGGGGCGGGCGGCGG + Exonic
1112580838 13:100675034-100675056 GTCGGCGGCGAAGGAGGCGCAGG + Intronic
1113541849 13:111115391-111115413 GGCCGCGCCGAGCCAATCGCCGG + Exonic
1113737771 13:112690357-112690379 GGGCGCGCCGAGCCGGGCGCGGG + Exonic
1114312126 14:21477133-21477155 GGCTGCAGAGAGTCAGGCGCTGG - Exonic
1114736722 14:25049998-25050020 AGCGGCGGCGAGCCAGCACCCGG - Exonic
1115592210 14:34874959-34874981 GGCGGCGGCGGGCGAGGAGCCGG - Intronic
1115851790 14:37595151-37595173 GGCGGCGGCGCGGCGGGCGGGGG + Intronic
1115985808 14:39102982-39103004 GGCGGCGGCGGGCTGGGGGCTGG - Intronic
1116657929 14:47674751-47674773 GGCGGCGGCGAGCGGAGCGCAGG + Exonic
1117680680 14:58200076-58200098 GGCCGCGGCGCGCCGGGCCCGGG - Intronic
1118607610 14:67515124-67515146 GCCGGCCGCCTGCCAGGCGCAGG + Exonic
1119725535 14:76919950-76919972 GGCAGCGGCGTGGCAGGCGGCGG + Intergenic
1119864992 14:77966122-77966144 GGAGGGGCTGAGCCAGGCGCCGG - Intergenic
1121092917 14:91195196-91195218 GACGGCAGGGAGCCAGGAGCAGG - Intronic
1121190643 14:92026466-92026488 GGCTGCGGCGAGCAAGGAGGCGG - Intronic
1122130722 14:99603436-99603458 GGCGGCGGCGGGGGCGGCGCCGG - Exonic
1122265898 14:100546675-100546697 GGCGGCGGCGGGCCGGGCCGCGG + Intronic
1122543298 14:102509492-102509514 GGCGGCCGCGGGCGCGGCGCGGG + Intronic
1122917336 14:104865215-104865237 GGCGGGGGCGTGCCCGGGGCGGG + Intergenic
1122975301 14:105168459-105168481 GGCGGCTGGGAGCCGGGCGCGGG - Exonic
1122993300 14:105248982-105249004 GGCGGCGGCGGCGCTGGCGCGGG - Exonic
1202860932 14_GL000225v1_random:80395-80417 GGCGGGGGCGTTTCAGGCGCTGG + Intergenic
1124427014 15:29570854-29570876 GGCGGCCGCGCGCCGGGAGCGGG + Intergenic
1124600836 15:31131806-31131828 GGTGGGGGCGAGCCTGGTGCTGG - Intronic
1125589325 15:40844577-40844599 GGCCGGGGCGAGGCGGGCGCGGG - Exonic
1125805596 15:42491009-42491031 GGCCGCCGAGAGCCAGGCGAGGG + Intronic
1125880060 15:43185724-43185746 GGCGGCGGGGAGCCGGGCTTGGG + Intronic
1126406967 15:48331767-48331789 GGCGGGGGGAAGCCCGGCGCCGG + Exonic
1127144116 15:56007300-56007322 GGCGGCGGCGGGGGAGGCGGCGG + Intergenic
1127144124 15:56007318-56007340 GGCGGCGGCGGGGGAGGCGGCGG + Intergenic
1127144132 15:56007336-56007358 GGCGGCGGCGGGGGAGGCGGCGG + Intergenic
1127144140 15:56007354-56007376 GGCGGCGGCGGGGGAGGCGGCGG + Intergenic
1128344128 15:66842820-66842842 GGCGGCGGCGGCGCCGGCGCGGG + Intergenic
1129203788 15:74023278-74023300 GGCGGCAGAGCGCCTGGCGCAGG - Exonic
1129264208 15:74385386-74385408 GGAGGCTGCCAGCCAGGCCCTGG - Intergenic
1129294361 15:74591808-74591830 GGCAGGGGTGAGCCAGGCTCAGG + Exonic
1129581741 15:76819019-76819041 GGCGGCAGCGAGGCAGGGGGAGG + Intronic
1129706493 15:77797602-77797624 GGCTGCTGGGAGCCAGGTGCTGG - Intronic
1130115552 15:81001906-81001928 GGCGGCGGCGAACCAGCAGAAGG + Exonic
1131060161 15:89399718-89399740 GAGGGCGGCGGGCCAGGCCCGGG + Intergenic
1131144435 15:90002031-90002053 GGCGGCGGCGCGGGAGGCCCGGG + Intronic
1132499842 16:280451-280473 GGCGGGGGCGACCCGGGTGCCGG + Intronic
1132499897 16:280619-280641 GGCGGCGGCGGGGCGGGCGGCGG + Exonic
1132589806 16:721710-721732 GGCGGCGAAGACCCAGACGCAGG - Intronic
1132604582 16:788421-788443 GGCGGGGGCGGGCCGGGGGCGGG - Intergenic
1132688596 16:1172444-1172466 GACGGAGGCGGGCCAGGCCCAGG - Intronic
1132704370 16:1236840-1236862 GGCGCGGCCGAGGCAGGCGCTGG + Intergenic
1132707146 16:1249585-1249607 GGCGCGGCCGAGGCAGGCGCTGG - Intergenic
1132807555 16:1782166-1782188 GCCAGCCGCGAGCCCGGCGCAGG - Intronic
1132891155 16:2205517-2205539 GGAGGCCGCGAGCCAGGGGCCGG + Intronic
1133156544 16:3880392-3880414 GGCGGCGGCGGGCCGCGGGCCGG - Exonic
1133259236 16:4537940-4537962 CACGTCGGCGAGCCGGGCGCGGG + Intronic
1134121348 16:11586870-11586892 GGCGGCGGTGAGTGCGGCGCGGG - Intronic
1134441531 16:14302123-14302145 GGCGGCAGCGGCCCAGGCGGCGG - Intergenic
1134849842 16:17470806-17470828 GCGGCCGGCGAGCGAGGCGCGGG + Exonic
1135517615 16:23148939-23148961 GGCGGCGGCGGGCACGGCGGCGG + Exonic
1136110850 16:28063040-28063062 GGCGGCGGCCAGCTCGGCTCCGG - Intronic
1136110984 16:28063546-28063568 GGCGGCGGCGGACGCGGCGCGGG + Intergenic
1136141613 16:28292449-28292471 GGCGGCGGCGCGCGAGCCGGAGG + Intergenic
1136453963 16:30370110-30370132 GGCGGCGGCGAGGGGGCCGCGGG + Exonic
1136479365 16:30532319-30532341 GGCAGCGGGGAGCAAGGTGCTGG + Exonic
1136536386 16:30902302-30902324 GGACGCGGCGCGCCAGGCCCGGG + Exonic
1137586367 16:49666125-49666147 GGCGGGGGCCAGCCAGGATCTGG - Intronic
1137617793 16:49857319-49857341 GGCGGCGGCAGGCACGGCGCGGG + Intronic
1138450726 16:57092408-57092430 TGCCGCGGCGCGCCGGGCGCGGG + Intergenic
1139364875 16:66427153-66427175 GGCGGCGGCTTCCCAGGCCCCGG - Intergenic
1139402937 16:66696642-66696664 GGCGGCGGCGGGCGGGCCGCGGG - Exonic
1139410092 16:66751793-66751815 GGCGGCGGTCAGGCAGCCGCCGG + Exonic
1140442640 16:74999309-74999331 GGCGGCGGCGAGCGGCGGGCGGG - Exonic
1141624274 16:85253200-85253222 GCCGGCGGCGAGGCAGGCCTTGG - Intergenic
1141989619 16:87602603-87602625 GGGGGCCGCGGGCCGGGCGCGGG - Intronic
1142156317 16:88534248-88534270 GGCCGCGGCGACTCGGGCGCGGG - Exonic
1142295292 16:89217681-89217703 GGCGGAGGCGGGGCCGGCGCCGG - Intronic
1142395349 16:89828572-89828594 GGCGGCGCCGCGGCGGGCGCAGG + Exonic
1143063326 17:4222108-4222130 TGCGGCGGGCGGCCAGGCGCCGG + Intronic
1146646628 17:34580896-34580918 GGAGGGGGCGTCCCAGGCGCTGG - Exonic
1146716303 17:35089345-35089367 GGCGGGGCCGAGTCAGGGGCGGG - Intronic
1147044464 17:37743070-37743092 AGCTGCGGCCAGCCCGGCGCGGG + Intronic
1147150332 17:38510456-38510478 GGCGGCCCCGGGCCAGGCGGCGG - Exonic
1147754797 17:42761213-42761235 GGCGGCGCTGAGCCGGGCCCGGG - Exonic
1148271755 17:46266996-46267018 GCGGGCGGCGAGCCGGGGGCCGG - Intergenic
1148299521 17:46534802-46534824 GGGGGCGGCTGGCCAGGCGGGGG + Intronic
1148768987 17:50056198-50056220 GACGGCGGCGACCCGGCCGCTGG + Intronic
1150388849 17:64779740-64779762 GGCGGGGGCGGGCCCGGCTCGGG - Intergenic
1150791889 17:68205750-68205772 GGCGGCGGCGGGGCCGGGGCAGG - Intergenic
1151370813 17:73645125-73645147 GGCAGCGGCGGCCGAGGCGCTGG - Intergenic
1151370877 17:73645349-73645371 GGCGGCCCCGAGCCAGGCCCGGG + Intergenic
1151557009 17:74851740-74851762 GGCGGCGGTGAGGCAGAGGCAGG - Intronic
1151812597 17:76453178-76453200 AGCGGCGGCGAACGAGGCGCGGG + Exonic
1152357716 17:79814836-79814858 GGCGGCGGCGGGAGGGGCGCGGG + Intergenic
1152476930 17:80524562-80524584 GGCTGCAGCCAGCCAGACGCTGG + Intergenic
1152644120 17:81460990-81461012 GGCAGCGGCCAGCAAGGGGCCGG + Exonic
1152719834 17:81918026-81918048 GGCGGCGGCGTACCTGGCGGAGG + Exonic
1152745629 17:82037401-82037423 CGAGGCGGCGAGCCAGGAGGGGG - Intronic
1152751785 17:82065687-82065709 GGCGGCGGCGAGGCCGGAGAGGG - Intronic
1152758919 17:82098349-82098371 GGCGGCGGCGCGCCGGGTCCCGG - Intergenic
1152790018 17:82273734-82273756 GGCCGCGGCGCTCCAGGGGCGGG + Intergenic
1152924099 17:83079736-83079758 GGAGCCGGCGAGCCGGGCGGGGG - Exonic
1152924150 17:83079873-83079895 GGCGGGGGCGGGCCCGGGGCGGG - Exonic
1153263779 18:3247979-3248001 GGCGGCGGGGCTCCTGGCGCCGG + Intronic
1153688108 18:7566909-7566931 GGCGGCTTCGAGCCTGGCGCCGG - Exonic
1153794499 18:8609764-8609786 GGCGGCGGCGGTCTGGGCGCGGG + Exonic
1153855090 18:9137213-9137235 GGCGGCGGCGGGCGGGGCCCCGG - Intronic
1153900482 18:9614145-9614167 GGCGGCGGCGAGGCCTGGGCCGG - Intronic
1153935219 18:9914577-9914599 GGCGGAGGGGAGCCCGGCCCTGG + Intronic
1154181151 18:12141062-12141084 GGCGGCAGCGAGGCTGGCGGAGG - Intergenic
1154377924 18:13824102-13824124 TGCGGAGGCGGGCCCGGCGCGGG + Intergenic
1154420042 18:14221883-14221905 GGGGGCGGCGCGGCAGGCCCCGG + Intergenic
1155055314 18:22177137-22177159 GCCGGCCGCGAGCCAGGGGCAGG - Intronic
1155392719 18:25352302-25352324 GGCGGCGGCGGGCGGGGCTCGGG - Intergenic
1155507631 18:26548421-26548443 GGCGAGGGCGAGCGCGGCGCGGG - Intronic
1158643070 18:59219858-59219880 GGCGCCGGCGAGCCTGGAGAGGG + Intergenic
1160453345 18:78979750-78979772 GGCGGCGGCGGGGGGGGCGCGGG + Intergenic
1160499125 18:79393900-79393922 GGTGGCCGCGCGCCAGGCGCAGG - Intergenic
1160662015 19:305716-305738 GGCGGCGGCGCGCCCTGCCCCGG - Exonic
1160698647 19:496336-496358 GGCGGCAGAGAGGCAGGGGCTGG - Intronic
1160719163 19:589997-590019 GGCGGCGGCGGCCCCGGCGCGGG - Exonic
1160810596 19:1011351-1011373 GGCTGCGGTGAGCGTGGCGCGGG - Exonic
1160853475 19:1205832-1205854 GGCGCCCGCGAGTGAGGCGCGGG + Intronic
1160904309 19:1445347-1445369 GGCGCCCGCGAGCCTGGAGCCGG + Intergenic
1160935480 19:1592650-1592672 GGCGGCGGCGGGCCCGGCGGCGG - Exonic
1160948032 19:1652418-1652440 GGCGGCGGCGCGCGTGGCCCGGG + Intronic
1160991766 19:1863129-1863151 GGCGGCGGAGGGCGCGGCGCCGG + Exonic
1161006664 19:1940716-1940738 GGCGGTGGCGGGCGCGGCGCGGG - Intergenic
1161257996 19:3320410-3320432 GGCGGCGGCCGGGCGGGCGCGGG - Intergenic
1161332133 19:3693404-3693426 GGTGGCGGGGAGGCAGGTGCAGG + Intronic
1161450705 19:4343860-4343882 GGCGGCGGCGGGGCCGGGGCGGG + Exonic
1161505217 19:4640034-4640056 GGTGGCGGGGAGCCAGGCCTAGG + Exonic
1161802630 19:6424544-6424566 GGCGGCGGCGGCCCGGGCGGGGG - Exonic
1161802639 19:6424559-6424581 GGCGGCGGCGGTCCCGGCGGCGG - Exonic
1161802692 19:6424655-6424677 GGCGGCGGCGGCCCGGGCGGGGG + Exonic
1161959599 19:7516308-7516330 GGCGGGGGAGCTCCAGGCGCGGG + Intronic
1161973368 19:7596101-7596123 GGCGGCGGCCAGCCTGGCGTGGG + Exonic
1162030912 19:7916901-7916923 GGCGGCGGCGTCAGAGGCGCAGG - Exonic
1162033208 19:7926059-7926081 GGCGGCGGCGGCCCGGGCTCCGG + Exonic
1162281508 19:9701436-9701458 GACGGGGTCGAGCCAGGTGCCGG - Intergenic
1162395829 19:10417710-10417732 GGCGGCGGCGAGGGCGACGCAGG - Intronic
1162533203 19:11247633-11247655 GGCGGCTGAGAGCCAGGCCCAGG + Intronic
1162758476 19:12874384-12874406 GGCGGCGCTGAGCCCGGTGCAGG + Exonic
1162778649 19:12995601-12995623 GGCAGCGGCGAGCGCGGCGGCGG + Exonic
1162934159 19:13972870-13972892 GGCGGCGGCGGGGGAGGCGGTGG - Exonic
1163158897 19:15453289-15453311 GGCGGCGGCGGGCAGGACGCCGG + Exonic
1163366483 19:16878577-16878599 GGAGGCGGCTAGCCTGGTGCAGG + Exonic
1163442480 19:17328812-17328834 GGCGGCGGGGCGCAGGGCGCCGG + Exonic
1163578595 19:18124677-18124699 GGCGGCTGAGGGCCATGCGCGGG + Exonic
1163585510 19:18161455-18161477 GGCGGCGGCGAGGACGGCGGCGG - Exonic
1163606998 19:18281082-18281104 GGTGGCGGCCAGCGAGGAGCAGG - Exonic
1163666698 19:18606888-18606910 GGCGGCGGGGAGGCCGGTGCGGG - Intronic
1163793300 19:19320874-19320896 GGCGGCAGCGGCCCAGGCGGCGG + Exonic
1164639069 19:29811806-29811828 GGCGCCGGCCCGCGAGGCGCAGG - Intergenic
1164693204 19:30226030-30226052 GGAGGCGGCGGCCCAGGCGCAGG - Intergenic
1165089159 19:33373700-33373722 GGCGGCGGCGCGCGCGGCCCCGG + Exonic
1165493919 19:36141048-36141070 GGCGGCGGCGGGGGAGGCGGGGG + Exonic
1166097364 19:40549263-40549285 GGAGCCGGCGAGCAAGGAGCTGG + Exonic
1166211019 19:41306612-41306634 GGAGGGGCCGAGGCAGGCGCTGG - Exonic
1166832200 19:45645474-45645496 GCCGGCGCCGGGCCCGGCGCTGG + Exonic
1166876604 19:45901743-45901765 GGCGGCGGCGGGCGAAGCGGAGG - Exonic
1168100394 19:54138248-54138270 GGCGGCGGCGGGCGGGGCCCGGG - Intronic
1168246955 19:55117289-55117311 GGCGGGGTCGAGCTCGGCGCCGG + Exonic
1168315193 19:55481989-55482011 GGCGGCGGGGCGGGAGGCGCGGG - Exonic
1168401492 19:56088226-56088248 GGCGGCGGGGGGCGAGGAGCCGG - Exonic
925413084 2:3651217-3651239 GGCGGCGCCCACACAGGCGCGGG + Intergenic
925419953 2:3703721-3703743 GGCCCCGGCGAGCGAGGAGCGGG + Exonic
925984731 2:9206729-9206751 GGCGGCGGCCGGCCGGGCGTGGG - Intergenic
926121123 2:10241596-10241618 GGATGCGGCGAGGCAGGGGCTGG - Intergenic
927089683 2:19700901-19700923 GGCAGGGGCAAGCCAGGCCCAGG + Intergenic
927591360 2:24360548-24360570 GGGGGCGGGGAGGTAGGCGCCGG + Exonic
927596628 2:24403158-24403180 GGGGGCGGGGGGCGAGGCGCGGG - Intergenic
927652394 2:24920332-24920354 TGGGGCGGCGAGGGAGGCGCCGG + Intergenic
927787262 2:25982452-25982474 GGCGGCGGCGGGGAAGGCGGAGG - Exonic
927943265 2:27118908-27118930 GGCGGCGGGAGGCGAGGCGCGGG - Exonic
927964777 2:27262250-27262272 GGGGGCGGCGAGGAAGGAGCAGG - Intronic
928421121 2:31138407-31138429 GGCGGCAGCGGGCAAGGCGGCGG - Intronic
929055793 2:37875121-37875143 GGTGGGGGCGAGCTGGGCGCTGG + Intergenic
929777716 2:44939065-44939087 GGCGGCAGGGCGGCAGGCGCTGG + Intergenic
929777792 2:44939315-44939337 GGAGCCGGGGACCCAGGCGCCGG - Intergenic
929936326 2:46297043-46297065 GGCGGCCGGGAGCCGGGCTCCGG - Intronic
930798703 2:55420064-55420086 GGCGGCGGCGAGGCTAGCCCGGG - Intergenic
931614575 2:64143788-64143810 GCGCGCGGCCAGCCAGGCGCGGG + Intronic
932306358 2:70706368-70706390 GGCGGCGGCGAGGCAGCCTCGGG + Exonic
933741809 2:85539533-85539555 GGCGGCCACGCGCCAGGCCCTGG - Intronic
935137719 2:100322065-100322087 GGCGGCGGCGGGACCGGCTCGGG + Exonic
935592561 2:104855622-104855644 GGCGGCGGCGGGGGCGGCGCAGG + Exonic
936073061 2:109384188-109384210 GCCGGCTGCGGGCCAGGCCCCGG + Intronic
937221811 2:120346288-120346310 GGCGGCGGCGCGGCAGGCGTCGG - Exonic
938073064 2:128318537-128318559 GGCGGCGGCGCGCCGGCGGCAGG - Exonic
938260890 2:129894781-129894803 GGCGGCGGCGGGCCAGGGTGTGG - Intergenic
938718470 2:134043173-134043195 GGCGGCAGCGAGCCTGGGGGAGG + Intergenic
939470391 2:142613374-142613396 GGCGGCGGCGAGGCTGGGGGAGG - Intergenic
939900499 2:147844583-147844605 GGCGGCGGCGGTGCAGGCGGCGG - Exonic
940401877 2:153257040-153257062 GGCGGCAGCGAGGCTGGCGGAGG - Intergenic
940751237 2:157628911-157628933 GGCGGAGGCGCGGCAGGGGCGGG - Exonic
941463092 2:165794045-165794067 AGCGGCGGCCGGGCAGGCGCTGG + Exonic
941686851 2:168456338-168456360 GGCGGCGGCGGCACAGGCTCGGG + Exonic
941987633 2:171523628-171523650 GCCCGCGGCGAGCCAGCCCCGGG + Intronic
942240813 2:173963732-173963754 GGCGGGGGCGGGCCGCGCGCGGG + Intronic
942458152 2:176151832-176151854 GGCAGCGCCGAGCCAGGCCCGGG - Exonic
944221749 2:197310513-197310535 GGCGGCGCGGAGCCCGGCGGGGG - Intronic
944412673 2:199458604-199458626 GGCGGCGACAAGGCAGTCGCTGG + Intronic
944565610 2:200987391-200987413 GGCTCCGGCGAGCCATGCTCAGG + Intronic
947592937 2:231395592-231395614 GGCGGCGGCGGGGCGGGCCCTGG + Exonic
947641154 2:231708570-231708592 GGCTGCGGCGAGCAAGGAGGCGG - Exonic
947992154 2:234496674-234496696 GGCGGCGGCGGGCGGGGCCCAGG - Exonic
948000472 2:234563003-234563025 CGGGGCGGCTAGCCAGGCGGGGG - Intergenic
948415325 2:237798796-237798818 GGCTGCGGAGAGCGGGGCGCTGG + Exonic
948487237 2:238288706-238288728 GGCGGCGGCGGGCGCGGGGCCGG - Intronic
948492145 2:238320568-238320590 GGCGGCGGCGGGGCCGGCGGCGG + Exonic
948622722 2:239246506-239246528 GGCGGGGGCCGGCCAGGCGCTGG + Intronic
948694197 2:239724991-239725013 GGCAGCGGGGAGACAGGCGTCGG - Intergenic
948772311 2:240257992-240258014 GGCGGCGGAGAGCCAGGAGCGGG + Intergenic
949003770 2:241633658-241633680 GGAGGCCGCCAGCCAGGAGCAGG - Exonic
1168855027 20:1002229-1002251 GGCGGCGGCACGGCGGGCGCGGG + Exonic
1169118671 20:3082948-3082970 GGCGGGGGCGGGCCTGGGGCTGG - Intronic
1169278451 20:4248779-4248801 GGCGGCGGCGTGGTGGGCGCAGG - Exonic
1170570054 20:17627521-17627543 GCTGGAGGCGGGCCAGGCGCGGG - Exonic
1170578688 20:17682266-17682288 GGAGGCGGCGATCCCGGCGGAGG - Exonic
1170623323 20:18011835-18011857 GGCTGCGGCGAGCAAGGAGCCGG - Intronic
1170847580 20:19975157-19975179 AGCGGCGGCCGGCCGGGCGCAGG + Exonic
1172037032 20:32018223-32018245 GGCGGGGGCGGGGCAGGGGCAGG + Intronic
1172118473 20:32584697-32584719 GGCGGCGGCGGGACTGGCGCGGG - Intronic
1172245599 20:33443403-33443425 GGCGCCGCGGAGCCGGGCGCCGG - Exonic
1172684909 20:36746112-36746134 GGCGGCGGCGAGAGGGGCGGGGG + Intergenic
1172843581 20:37916286-37916308 GGGGGCAGGGAGCCAGGAGCCGG - Intronic
1174066449 20:47869079-47869101 GGCTGCGATGAGCCAGGCGGAGG - Intergenic
1174317459 20:49713751-49713773 GGCGGCGGCGGCCCAGGAGGCGG - Exonic
1175994133 20:62804833-62804855 GGCGGCGGCGGGGCTCGCGCTGG - Exonic
1176062317 20:63177826-63177848 GGCGGCGGCGCGGGAGGCGCAGG + Intergenic
1178707639 21:34888810-34888832 GGCGGCGGCGAGCCGCGCCCTGG - Intronic
1179674892 21:42974695-42974717 GGCGGCGGCGAGAGCGGCGGCGG - Intronic
1179675076 21:42975234-42975256 GGCGGCCGCGACCCCGGCCCCGG + Intronic
1181316615 22:21974723-21974745 GGCTGCCGGGAGCCAGGAGCAGG + Intronic
1181514282 22:23402430-23402452 GGCTGCGGGGAGACGGGCGCCGG - Intergenic
1181793031 22:25282721-25282743 GGGGGCGGCGCGCGAGGCGGCGG + Intergenic
1182445503 22:30387273-30387295 GGCGGCGGCGATCTCAGCGCGGG + Exonic
1183255140 22:36757128-36757150 GGCGGCTGGGAGCCGGGCTCTGG + Intergenic
1183665196 22:39242745-39242767 TGCGGCCTCCAGCCAGGCGCAGG - Intronic
1184067728 22:42129816-42129838 GGCGGCCGTGCGCGAGGCGCTGG - Exonic
1184412230 22:44331876-44331898 GGCGGCGGCGGGCGCGGCGCGGG - Intergenic
1184500030 22:44865860-44865882 GGCGGCAGCGAGTGACGCGCAGG + Intergenic
1185055257 22:48575853-48575875 CGCCGCGGCGGGCCAGGCTCGGG - Intronic
950000031 3:9649588-9649610 GGCGGCGGCGGCCCGAGCGCCGG - Exonic
950282299 3:11719172-11719194 GACCGCGGGGTGCCAGGCGCGGG + Intronic
950729772 3:14947548-14947570 CGCGGCGGCGAGGCTGGCGCTGG + Intergenic
951217729 3:20040505-20040527 GGCGGCTGCGGGGCAGGAGCCGG + Exonic
952942279 3:38454046-38454068 GGCGGCGGCGGGGCACGGGCCGG - Exonic
953427021 3:42804072-42804094 GACGGCGGGGAGCGAGGAGCGGG - Intronic
954146252 3:48635702-48635724 GACTGCGGCCAGCCCGGCGCGGG - Intergenic
954399335 3:50311548-50311570 TGGGGCGGCTAGCCAGGCGGGGG + Intronic
954689815 3:52389679-52389701 GGCAGCTCCGAGCCAGGCCCTGG - Intronic
956659491 3:71583814-71583836 GGCGGCGGCGGCAGAGGCGCGGG + Intronic
956678029 3:71753683-71753705 GGCGGCGGCGGGCCCGGCGGGGG + Intronic
957085472 3:75672588-75672610 GCCGGCGGCCAGCCTCGCGCAGG + Intergenic
958026892 3:88059273-88059295 GGCGGCGGCGGCGCAGGGGCTGG + Exonic
958026982 3:88059668-88059690 GGGGGCGGGGAGCAAGGCGAGGG + Intronic
958791618 3:98657564-98657586 GGCGGCAGCCACCCAGGCGTCGG - Intergenic
959539866 3:107525229-107525251 GGCAGCGCCGGGCCGGGCGCCGG + Intronic
959591893 3:108090916-108090938 GGCGGCGGCGACCCCGCGGCGGG - Exonic
961305703 3:125958296-125958318 GGCTGCCGCGAGCTAGGCGCTGG + Intergenic
961735930 3:129002153-129002175 GGCGGCGGCGCGGACGGCGCAGG - Exonic
962498629 3:135966489-135966511 GGCGGCGGCCAGGTCGGCGCGGG - Intronic
966182129 3:177197299-177197321 GGGGGCGGGGAGCGCGGCGCGGG + Intronic
967924187 3:194633387-194633409 GGCGGCGGCGGCGAAGGCGCCGG + Exonic
968086003 3:195874135-195874157 GGCTGCCGCGGGCCAGACGCCGG + Intronic
968258190 3:197297998-197298020 GGCCGCGGCGAGCGAGGAGGCGG - Intronic
968477363 4:818293-818315 GGTGGCGGCCAGCCAGGCCCAGG - Intronic
968506474 4:973435-973457 GCCGCCGCCCAGCCAGGCGCGGG + Exonic
969075631 4:4575549-4575571 GGAGGCAGCGAACCGGGCGCCGG - Intergenic
969413378 4:7043540-7043562 GGCTGCGGCGGGCCGGGCGGCGG + Exonic
969425100 4:7119745-7119767 GGCGGCCGGGAGCCATCCGCAGG - Intergenic
969492105 4:7505304-7505326 GCCGGCGGGGAGCCAGGCACGGG + Intronic
970333310 4:15004734-15004756 GGCGGCGGCCCTCCAGGCCCAGG - Intronic
972960650 4:44448425-44448447 GGCGGCGGCGGCCGACGCGCCGG + Exonic
974047559 4:56909340-56909362 GCCGCCGCCGAGGCAGGCGCTGG + Intronic
975345937 4:73292889-73292911 GGCCCCTCCGAGCCAGGCGCGGG + Intergenic
975410011 4:74038585-74038607 GGCGGCGGAGAGCGTGGCGTGGG + Exonic
975415399 4:74099094-74099116 GGCGGCGGAGAGCGTGGCGCGGG + Exonic
976246468 4:83010786-83010808 GGCGGCGGCGGCCCGGGCTCCGG - Exonic
976390405 4:84499398-84499420 GGGGCCGGCGAGCCGGGCGCAGG + Intergenic
976390439 4:84499515-84499537 GGCTGAGGCGGGCCAGGCGTAGG + Intergenic
979523780 4:121696901-121696923 AGCGGCGGAGAGCCGGGCGACGG + Exonic
981044542 4:140253106-140253128 GGCTTCGGCGACCCAGGAGCAGG - Intergenic
981429888 4:144646232-144646254 GGCGGCGGCGGGGCAGGCGGAGG - Exonic
982198174 4:152936433-152936455 GGCGGGGGCGACCGCGGCGCGGG + Intronic
982745598 4:159102637-159102659 GGCGGCGTGGCGCCAGGAGCGGG + Intergenic
983148028 4:164242031-164242053 GGCGGCAGCGAGGCAGGGGGAGG + Intronic
983402572 4:167284108-167284130 GGGGGTGGAGAGCCAGGGGCAGG - Intergenic
985588162 5:751425-751447 GGGGGCGGGGAGGCAGGGGCAGG + Intronic
985602832 5:843888-843910 GGGGGCGGGGAGGCAGGGGCAGG + Intronic
985675129 5:1227023-1227045 GGCGTCGGCGGGCAAGGCGTTGG - Intronic
985675147 5:1227083-1227105 GGCGTCGGCGGGCAAGGCGTCGG - Intronic
985675151 5:1227098-1227120 GGCGTCGGCGGGCAAGGCGTCGG - Intronic
986608619 5:9546167-9546189 GGCGGGGGCGGGGCAGGGGCGGG - Intergenic
986693740 5:10333965-10333987 GGCAGCGGCGACCCAGGGGCTGG + Intergenic
987258150 5:16179097-16179119 GGCGGCGGCGACCAGCGCGCTGG - Exonic
987725960 5:21699856-21699878 GGAGGTGGCCAGCCAGGCTCTGG + Intergenic
988609873 5:32713637-32713659 AGCGGAGTTGAGCCAGGCGCCGG + Intronic
992391619 5:76336027-76336049 GGGGGCGGCTAGCCGGGCGGGGG + Intronic
992460271 5:76953839-76953861 CGCGGAGGCGCGCCAGGAGCGGG + Intronic
992550141 5:77851994-77852016 GGTGGCGGGGAGCCGGGAGCCGG - Intronic
994072737 5:95620480-95620502 GGCGGCGGCGGGCCCTGGGCGGG + Exonic
994094318 5:95835131-95835153 GGCGGCGGCGAGGCAGTCACTGG - Intergenic
996442996 5:123512613-123512635 GGCCGCGCCGAGGCAGCCGCCGG - Intronic
996443034 5:123512694-123512716 GGGGGCGGCGCCGCAGGCGCGGG + Intronic
997539323 5:134648714-134648736 GGCTGCTGCGAGCCCGGAGCCGG + Intronic
997560974 5:134846048-134846070 GGCGGCGGCGAGGCAGGCGCTGG - Exonic
998319556 5:141216148-141216170 GGCGGCCCCGACCCAGGCCCAGG + Exonic
999768170 5:154756040-154756062 GGCGGCGGCGAGCCAGGCGCTGG + Intronic
1001748022 5:174107162-174107184 GGCTGCTGCGTGCCAGGCCCAGG + Intronic
1002000674 5:176194847-176194869 GGCGGGGGCCAGGCAGGGGCAGG + Intergenic
1002253665 5:177944134-177944156 GGCGGGGGCCAGGCAGGGGCAGG - Intergenic
1002277522 5:178113628-178113650 AGCGGCGGAGCGGCAGGCGCCGG - Exonic
1002566878 5:180117106-180117128 GGTGGCGGCCTGCCAGGAGCCGG - Intronic
1002897998 6:1390176-1390198 GGCGGCGGCGGCGCGGGCGCCGG + Exonic
1003345195 6:5260601-5260623 GGGGGCGGGGGGCCAGGGGCCGG - Intronic
1003569467 6:7246744-7246766 GGCGACGGCGAGGCAGGCGCCGG + Exonic
1004321403 6:14634228-14634250 GGTGGGGGCGATCCAGGGGCGGG + Intergenic
1004627921 6:17393926-17393948 GGGCGCGGCGACCCGGGCGCGGG + Intronic
1004924045 6:20402351-20402373 GGCGGCGGCGAAGCCGGGGCTGG - Exonic
1005473927 6:26188950-26188972 CGCCGCGGCGAGCCAGGCGGCGG + Exonic
1005484327 6:26285373-26285395 CGCCGCGACGAGCAAGGCGCCGG + Exonic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1006547470 6:34791953-34791975 GGCGGCGGCGCGCGCAGCGCCGG - Intergenic
1007432878 6:41786639-41786661 GGCGGCGGCGCGCACGGCCCAGG + Intronic
1007557817 6:42782014-42782036 GGCGGCGGCGGGCGCGGGGCCGG - Exonic
1007701917 6:43770781-43770803 CGCGGCGGCGAGCCGCGGGCAGG + Exonic
1008378688 6:50819878-50819900 GGCCGAGGCGGGCGAGGCGCGGG + Intronic
1008406279 6:51121855-51121877 GGCGGCAGCGAGGCAGGGGGAGG + Intergenic
1008915780 6:56785424-56785446 GGCGGCAGCGAGGCTGGCGGAGG - Intronic
1009431635 6:63572576-63572598 GGTGGCGGCGATGCAGGCGGCGG - Exonic
1009431653 6:63572644-63572666 GGCGGCGGCGACACAGGCGGTGG - Exonic
1010319357 6:74488794-74488816 TGGGGCGGCTAGCCAGGCGGGGG - Intergenic
1010422151 6:75688189-75688211 GGAGCCGCCGAGCCAGGCACGGG + Intronic
1011244444 6:85307456-85307478 GGCGGCGGCGAGGCTGGGGGAGG + Intergenic
1011416255 6:87122776-87122798 GGCGGCGGCGGGCCTGGGGCCGG + Intergenic
1011517227 6:88166892-88166914 GGCGGCAGCGAGCTGGGCCCGGG + Intergenic
1011692938 6:89886798-89886820 AGGGGCAGCCAGCCAGGCGCAGG + Intergenic
1012237669 6:96837432-96837454 GGCGGCGGCGATACAGGCGGCGG + Exonic
1012401261 6:98844388-98844410 GGGGGCGGCGGGCACGGCGCTGG - Intergenic
1012466353 6:99520979-99521001 GGCGCCGGAGAGCCTGGAGCAGG + Intronic
1013170796 6:107634948-107634970 GCCGCCGGCGACCCAGGCCCGGG + Exonic
1014019523 6:116571477-116571499 GGCGGCGGCCAGGCGGGCGCAGG - Exonic
1014702946 6:124712406-124712428 GGCGGCAGCGAGCCTGGGGGAGG - Intronic
1014704192 6:124726111-124726133 GGCGGCAGCGAGCCTGGGGGAGG + Intronic
1015261275 6:131240693-131240715 GGACCCGCCGAGCCAGGCGCAGG + Intronic
1016244963 6:141969945-141969967 GGCGGCAGCGAGCCTGGGGGAGG + Intergenic
1017671971 6:156777710-156777732 GGCGGCGGCGGCGCGGGCGCGGG + Intergenic
1017877645 6:158537217-158537239 GGGGGCGGCGAGGCGGGCGCGGG - Intronic
1018020917 6:159761884-159761906 GGCGGAGGCGCGCGGGGCGCGGG - Exonic
1018331037 6:162727684-162727706 GGCGGCTGCGGGCCAGGAACAGG + Exonic
1018876516 6:167826844-167826866 GGCGGCGGCGCGCACGGCGGCGG + Intergenic
1019112080 6:169724465-169724487 GGCCGTGGGGAGCCAGGCGGCGG - Intronic
1019448199 7:1082296-1082318 GGCGCCGCGGAGCCACGCGCTGG - Intronic
1019563940 7:1670550-1670572 GGCGGCGGCGGAGCGGGCGCAGG + Intergenic
1019662486 7:2232601-2232623 GGCTGCGGAGACCCAGGCGAGGG + Intronic
1019663872 7:2241858-2241880 GCCGGGGGCGAGCCCGGGGCGGG - Intronic
1019711492 7:2520041-2520063 GGCGGCGGCGCCCGGGGCGCTGG + Exonic
1019989610 7:4682450-4682472 GGCGGCGGCGGCCCGGGCGGAGG - Exonic
1020118020 7:5487230-5487252 GCCGGCGTGGAGCCAGGCACAGG + Intronic
1020727304 7:11831923-11831945 TGGGGCTGCAAGCCAGGCGCTGG - Exonic
1021106794 7:16646548-16646570 GGCGGGGGCCAGCCACGCGGTGG + Intronic
1021744248 7:23722795-23722817 GGCGGCGGCGAGGCTGGGGGAGG - Intronic
1021969379 7:25951419-25951441 GGCGGGGGCGCGGCCGGCGCTGG + Intergenic
1022101967 7:27174173-27174195 GGCAGAGGCGAGGCAGGCGGCGG - Exonic
1024043810 7:45574434-45574456 GGCGGCGGGCGGCGAGGCGCCGG - Intronic
1026045636 7:66903949-66903971 GGCCGCGGCGAGGCACGAGCCGG - Intergenic
1026360263 7:69597461-69597483 GGCGGCCGCGGGCGAGGGGCGGG - Intergenic
1026732773 7:72925629-72925651 GGCGGTGGGGAGCGCGGCGCCGG - Intronic
1026785695 7:73300454-73300476 GGCGGAGGCAAGCGAGGAGCCGG - Intergenic
1026806828 7:73434112-73434134 GGCTGCGCCGTGCCAGGCGGTGG + Exonic
1027025897 7:74851445-74851467 GGCGGCCGAGAGCCCCGCGCGGG + Exonic
1027061860 7:75092665-75092687 GGCGGCCGGGAGCCCCGCGCGGG - Exonic
1028252829 7:88556627-88556649 GGCGGCGGCGAGGCTGGGGGAGG - Intergenic
1031966597 7:128031796-128031818 GCCGGCGGCGCGCCGGGGGCCGG - Intronic
1032240373 7:130154705-130154727 GGCGGCGCGAAGCCAGGCGGAGG - Intergenic
1033148337 7:138890884-138890906 GGTGGCAGAGAGCCAGGCCCTGG - Intronic
1033186423 7:139231270-139231292 GGCCGCGGCGACCCTGGCGATGG + Intronic
1033253605 7:139779975-139779997 GGAGGAGGTGAGCCAGGCACAGG - Intronic
1033339238 7:140479126-140479148 CGCGGCGGAGCGCCGGGCGCGGG - Intronic
1033684141 7:143623309-143623331 GGTGGCTGAGAGCCAGGAGCAGG - Intronic
1033687317 7:143702528-143702550 GGTGGCTGAGAGCCAGGAGCAGG - Intronic
1033700471 7:143834314-143834336 GGTGGCTGAGAGCCAGGAGCAGG + Intergenic
1034426925 7:151018805-151018827 GGCGGCGGGGCGGTAGGCGCGGG + Exonic
1034496873 7:151428452-151428474 GGCGGTAGCCTGCCAGGCGCAGG + Intergenic
1035580702 8:737841-737863 GGCTGCCGGGAGCCGGGCGCGGG + Intronic
1035629800 8:1098622-1098644 GGCGGCCGGGAGCCTGGCGTGGG - Intergenic
1035629813 8:1098659-1098681 GGCGGCCGGGAGCCTGGCGTGGG - Intergenic
1035629827 8:1098696-1098718 GGCGGCCGGGAGCCTGGCGTGGG - Intergenic
1035629841 8:1098733-1098755 GGCGGCCGGGAGCCTGGCGTGGG - Intergenic
1035629855 8:1098770-1098792 GGCGGCCGGGAGCCTGGCGTGGG - Intergenic
1035900698 8:3456019-3456041 GGCGGCGGCGAGGCTGGGGGAGG - Intronic
1036390300 8:8318874-8318896 GGCGGGGGCGGGCCCGGGGCCGG + Exonic
1036733269 8:11284686-11284708 GGCCGCGGGGAGACAGGGGCTGG - Exonic
1037313136 8:17577169-17577191 GGAGGCGGCGGGCGAGGGGCGGG - Exonic
1037879442 8:22565817-22565839 GGCGCCGGCGAGCTCTGCGCGGG - Exonic
1037882412 8:22579543-22579565 GGCGGCCGCGAGCCGGCCTCGGG + Intronic
1038540342 8:28385856-28385878 GGCCGCGGCGGGCGGGGCGCGGG - Intronic
1038883666 8:31640290-31640312 GGCGGCGGCGGGCGAGGCAGGGG + Intronic
1039068782 8:33632008-33632030 GGCGGCGTGGAGCAAGGAGCGGG - Intergenic
1039542301 8:38382235-38382257 GGCGGCGGCGGGAGAGGCGGCGG - Exonic
1039936598 8:42051642-42051664 GGCGGCGGCGCGCGGGCCGCGGG + Intronic
1040386426 8:46917833-46917855 GCAGGGGGCGCGCCAGGCGCGGG + Intergenic
1041383547 8:57277072-57277094 AGCTGCACCGAGCCAGGCGCGGG - Intergenic
1041686941 8:60652602-60652624 GGCGCGGGCGAGCCGGGGGCGGG + Intergenic
1042271554 8:66961594-66961616 GGCGGCGGCGAATGCGGCGCGGG - Exonic
1042591527 8:70402869-70402891 GGGGGCGGGGAGCCGGGGGCCGG - Intronic
1043119785 8:76308524-76308546 GGCGGCAGCGAGGCTGGGGCAGG + Intergenic
1043725159 8:83602041-83602063 GGAGGCACCGAGCCAGGCCCGGG - Intergenic
1044242414 8:89902572-89902594 GCCTGCAGGGAGCCAGGCGCCGG - Exonic
1044335981 8:90985242-90985264 GGCGGCGGGGGGCGAGGGGCGGG + Exonic
1045432201 8:102124352-102124374 GGAGGCGGCGAGCCAGGCTGGGG - Intronic
1045607035 8:103788859-103788881 GGCGGCGGCGAGGCTGGGGGAGG - Intronic
1049151897 8:141040449-141040471 GGCAGCTGCTAGCCAGGCACAGG - Intergenic
1049275432 8:141717896-141717918 GGAGGGGGCGTGCCAGGAGCTGG - Intergenic
1049405321 8:142449718-142449740 GGCGGCGGCGGGCGCGGCGTTGG + Exonic
1049645580 8:143734233-143734255 GGCGGCGTCGAGCCCCGGGCGGG + Intergenic
1049762278 8:144336909-144336931 GGCGGCGGCGGGCGGGGGGCGGG + Intergenic
1050744122 9:8857667-8857689 GGCGGCGGCGCGGGAGGCGGTGG - Intronic
1053250819 9:36572815-36572837 GGCGGGGGCGCGCGCGGCGCCGG - Intergenic
1053690457 9:40584306-40584328 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1053690463 9:40584324-40584346 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1054274320 9:63053073-63053095 GGCGGAGGCGAGGCGGGCGGCGG + Intergenic
1054274341 9:63053143-63053165 GGCGGCGGCGAGGCGGGCGGCGG + Intergenic
1054301700 9:63385231-63385253 GGCGGCGGCGAGGCGGTCGGCGG - Intergenic
1054301705 9:63385249-63385271 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1054400482 9:64711785-64711807 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1054400488 9:64711803-64711825 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1054400510 9:64711873-64711895 GGCGGCGGAGAGGCGGGCGGCGG - Intergenic
1054434068 9:65196029-65196051 GGCGGCGGCGCGGCGGGCGGCGG - Intergenic
1054434074 9:65196047-65196069 GGCGGCGGCGCGGCGGGCGGCGG - Intergenic
1054434080 9:65196065-65196087 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1054434086 9:65196083-65196105 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1054434092 9:65196101-65196123 GGCGGAGGCGAGGCGGGCGGCGG - Intergenic
1054434101 9:65196130-65196152 GGCGGAGGCGAGGCGGGCGGCGG - Intergenic
1054434110 9:65196159-65196181 GGCGGAGGCGAGGCGGGCGGCGG - Intergenic
1054496290 9:65825555-65825577 GGCGGAGGCGAGGCGGGCGGCGG + Intergenic
1054496299 9:65825584-65825606 GGCGGAGGCGAGGCGGGCGGCGG + Intergenic
1054496305 9:65825602-65825624 GGCGGCGGCGAGGCGGGCGGCGG + Intergenic
1054496311 9:65825620-65825642 GGCGGCGGCGAGGCGGGCGGCGG + Intergenic
1054496317 9:65825638-65825660 GGCGGCGGCGAGGCGGGCGGCGG + Intergenic
1054496322 9:65825656-65825678 GGCGGCGGCGAGGCGGACGGCGG + Intergenic
1055945527 9:81688711-81688733 GGCGGCGGCGGGCGAGGTGCAGG + Exonic
1056475271 9:86946736-86946758 GGCGGCGGCGAGGCCCGCGGGGG - Exonic
1056637975 9:88347181-88347203 GGCTGCGGTGAGCCAGGATCTGG + Intergenic
1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG + Intergenic
1057649727 9:96909958-96909980 AGCCGCGGCGAGCAAGGAGCTGG - Intronic
1060152904 9:121299969-121299991 GGCGGGGGCGCCCCAGGGGCGGG + Exonic
1060302211 9:122381393-122381415 GGAAGCGGCGGGCCAGGAGCTGG - Exonic
1060468633 9:123929848-123929870 GGCGGAGCCGGGCCGGGCGCGGG - Intronic
1060605202 9:124907850-124907872 GGAGGAGGAGAGCCAGGTGCAGG + Intronic
1060770148 9:126326731-126326753 CGCGGCGGCGGGCCGGGCTCCGG - Intergenic
1060819758 9:126654533-126654555 GGAGGCAGCCAGCCAGGGGCTGG + Intronic
1061241700 9:129378340-129378362 GGCAGGGGAGAGCCAGACGCCGG - Intergenic
1061472123 9:130835203-130835225 GGCGGCGGCGGGGCGGGGGCGGG + Intronic
1061540734 9:131276912-131276934 GGCCGCGGCGAAGCAGGCGGCGG - Intergenic
1061623005 9:131823946-131823968 CGCCGCGGAGAGCCCGGCGCCGG + Intergenic
1061805875 9:133137600-133137622 GGCAGAGGCAAGCCAGGCGGGGG + Intronic
1061947408 9:133916468-133916490 GGTGGCAGAGAGCCAGGCTCTGG - Intronic
1061990865 9:134157835-134157857 GGCGTCCCCGACCCAGGCGCAGG + Intronic
1062216365 9:135391890-135391912 GGCGGCGGGGACTCAGGCTCGGG - Intergenic
1062230650 9:135479937-135479959 GGAGGCGGCGGGCCGGGGGCGGG - Exonic
1062499093 9:136844727-136844749 ACCGGCGGCGAGGCGGGCGCGGG - Exonic
1062519837 9:136953070-136953092 GGCGGCTGGGACCCAGGCCCGGG - Intronic
1203746615 Un_GL000218v1:43783-43805 GGCCGCAGAGACCCAGGCGCTGG - Intergenic
1203563491 Un_KI270744v1:75697-75719 GGCCGCAGAGACCCAGGCGCTGG + Intergenic
1185506447 X:634904-634926 GACGGCGGCGGCCCGGGCGCAGG - Intronic
1185508286 X:644533-644555 GGCGGCGGCGACCACGGCGGCGG - Exonic
1185778768 X:2828723-2828745 GGCCGCGGCGGGCGAGGGGCGGG + Intergenic
1186496500 X:10015710-10015732 GGCGGCGGCGCGGAAGGAGCTGG - Exonic
1187507291 X:19887805-19887827 GGCCGCGTCGGGGCAGGCGCCGG + Intergenic
1189341142 X:40205524-40205546 GGCGGCGCCGAGCGAGTCCCGGG + Intergenic
1190440476 X:50470578-50470600 GGCGGCGGCGGCCAAGGCGGCGG + Exonic
1191637417 X:63393365-63393387 GGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1191830206 X:65407585-65407607 GGCGGCGGCGGGCGAGGCGCAGG - Intronic
1192315738 X:70050032-70050054 GGCGGAGGCTAGCCAGAGGCTGG - Intergenic
1195716843 X:107826308-107826330 GGCGGCGGCGACCGGGGCCCGGG + Exonic
1197766072 X:130060278-130060300 GGCGGCGGCGCGCGAGGGGAGGG + Intergenic
1198184154 X:134237414-134237436 AGGGGCGGGGAGCCAGGGGCAGG + Intronic
1198388043 X:136147400-136147422 GGGCGCGGCTAGCCAGGGGCGGG - Exonic
1198767089 X:140091328-140091350 GGCGGCGGCGACCGAGGCGGCGG + Intergenic
1199721321 X:150544577-150544599 GGCCTCGGTGAGCCAGGCCCTGG - Intergenic
1200100775 X:153688398-153688420 GGCGGCGGGGTGCGGGGCGCGGG - Exonic
1201159942 Y:11158797-11158819 GGCTGCAGAGATCCAGGCGCTGG - Intergenic