ID: 999768230

View in Genome Browser
Species Human (GRCh38)
Location 5:154756224-154756246
Sequence GGGGGCCTCTTCCGGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999768213_999768230 11 Left 999768213 5:154756190-154756212 CCAGGTGGGTCTCCCTCCTTGCC 0: 1
1: 0
2: 0
3: 24
4: 298
Right 999768230 5:154756224-154756246 GGGGGCCTCTTCCGGGGACATGG No data
999768208_999768230 16 Left 999768208 5:154756185-154756207 CCCCCCCAGGTGGGTCTCCCTCC 0: 1
1: 0
2: 7
3: 28
4: 393
Right 999768230 5:154756224-154756246 GGGGGCCTCTTCCGGGGACATGG No data
999768212_999768230 12 Left 999768212 5:154756189-154756211 CCCAGGTGGGTCTCCCTCCTTGC 0: 1
1: 0
2: 0
3: 26
4: 203
Right 999768230 5:154756224-154756246 GGGGGCCTCTTCCGGGGACATGG No data
999768223_999768230 -10 Left 999768223 5:154756211-154756233 CCCTCCTGGGTCCGGGGGCCTCT 0: 1
1: 1
2: 1
3: 27
4: 253
Right 999768230 5:154756224-154756246 GGGGGCCTCTTCCGGGGACATGG No data
999768216_999768230 -1 Left 999768216 5:154756202-154756224 CCCTCCTTGCCCTCCTGGGTCCG 0: 1
1: 0
2: 2
3: 29
4: 351
Right 999768230 5:154756224-154756246 GGGGGCCTCTTCCGGGGACATGG No data
999768210_999768230 14 Left 999768210 5:154756187-154756209 CCCCCAGGTGGGTCTCCCTCCTT 0: 1
1: 0
2: 4
3: 25
4: 238
Right 999768230 5:154756224-154756246 GGGGGCCTCTTCCGGGGACATGG No data
999768221_999768230 -5 Left 999768221 5:154756206-154756228 CCTTGCCCTCCTGGGTCCGGGGG 0: 1
1: 0
2: 1
3: 39
4: 533
Right 999768230 5:154756224-154756246 GGGGGCCTCTTCCGGGGACATGG No data
999768217_999768230 -2 Left 999768217 5:154756203-154756225 CCTCCTTGCCCTCCTGGGTCCGG 0: 1
1: 0
2: 0
3: 33
4: 341
Right 999768230 5:154756224-154756246 GGGGGCCTCTTCCGGGGACATGG No data
999768211_999768230 13 Left 999768211 5:154756188-154756210 CCCCAGGTGGGTCTCCCTCCTTG 0: 1
1: 0
2: 5
3: 168
4: 2952
Right 999768230 5:154756224-154756246 GGGGGCCTCTTCCGGGGACATGG No data
999768209_999768230 15 Left 999768209 5:154756186-154756208 CCCCCCAGGTGGGTCTCCCTCCT 0: 1
1: 0
2: 6
3: 34
4: 332
Right 999768230 5:154756224-154756246 GGGGGCCTCTTCCGGGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999768230 Original CRISPR GGGGGCCTCTTCCGGGGACA TGG Intronic
No off target data available for this crispr