ID: 999773391

View in Genome Browser
Species Human (GRCh38)
Location 5:154792325-154792347
Sequence GCAAAATTATTCCCTGCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999773391_999773396 9 Left 999773391 5:154792325-154792347 CCTGTTGCAGGGAATAATTTTGC 0: 1
1: 0
2: 0
3: 10
4: 173
Right 999773396 5:154792357-154792379 CCTCAGCACCGCTGTCCTGAAGG 0: 1
1: 0
2: 0
3: 20
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999773391 Original CRISPR GCAAAATTATTCCCTGCAAC AGG (reversed) Intronic
901907563 1:12427318-12427340 GCAAAATTATTTACTTCCACTGG - Intronic
905274270 1:36806980-36807002 GCAAAATCTTCCCCTGAAACAGG - Intronic
906022978 1:42647242-42647264 GAAAAGATATTCCATGCAACTGG + Intronic
908507422 1:64818629-64818651 GGAGAATTATTCCTTGAAACAGG + Intronic
909521392 1:76572543-76572565 GCAAAATTCTTCCCAGAAACTGG - Intronic
910797247 1:91110084-91110106 GAAAAAATATTCCATGCAAATGG + Intergenic
911795341 1:102068933-102068955 GCAAAATTATTGCAGGCAGCAGG + Intergenic
911909041 1:103608561-103608583 GCTAAATTATTACCTGTTACTGG + Intergenic
911913878 1:103670900-103670922 GCTAAATTATTACCTGTTACTGG - Intronic
912143872 1:106767468-106767490 TCAAAAATAATCTCTGCAACTGG - Intergenic
912175294 1:107148242-107148264 GCTAAATTATTATCTGCAATTGG + Exonic
912739278 1:112178482-112178504 GCAAGATTGTTCCCTTCATCTGG + Intergenic
912778682 1:112524115-112524137 AAGAAATTACTCCCTGCAACAGG - Exonic
912858639 1:113193514-113193536 GAAACATTATTTCCTGCAAGAGG + Intergenic
915121076 1:153629803-153629825 GCAAAATTATCCCTTCCATCTGG - Intronic
915226209 1:154413353-154413375 GCAAAGTTATTCCCCACAGCAGG - Intronic
916220459 1:162439347-162439369 AGAAAAATATTCCATGCAACTGG - Intergenic
916402802 1:164467374-164467396 GCAAAATTATCCAATGCAAATGG + Intergenic
916558228 1:165911077-165911099 GGAAAATATTTCCCTGCAAGAGG - Intronic
916818300 1:168374147-168374169 GAACAATTATTCCCTTCAGCAGG - Intergenic
919485481 1:198141413-198141435 GAAAAATTATTCCATGCAAATGG - Intergenic
919732742 1:200923995-200924017 GCAAAATTACCACCTGAAACAGG + Intergenic
920637064 1:207713958-207713980 GGGAAGTTATTCCATGCAACAGG - Intronic
924756728 1:246947878-246947900 GCAAAATTATTGCAAGGAACGGG + Intronic
1063975934 10:11415568-11415590 GAAAAATTATTTCCTGCTTCTGG + Intergenic
1066308637 10:34173095-34173117 GCAAAATTAATGCCTGCAATAGG - Intronic
1071940174 10:90581886-90581908 GCAAAATGATTAGCTGCAAATGG - Intergenic
1072650065 10:97288283-97288305 GAAAGATTAATCCCTGCAGCCGG + Intronic
1072847537 10:98848793-98848815 GGAAAATTCTTCCCTGCATGTGG - Intronic
1073634571 10:105184097-105184119 CCAAAACTCTTCCCTGCAAGTGG - Intronic
1078700498 11:13676821-13676843 GAAAAATTATTAACTCCAACAGG - Intronic
1080142777 11:28942705-28942727 GCACAATAATTGCCTGAAACTGG - Intergenic
1081143279 11:39530965-39530987 GAAAAAATATTCCGTGCAAATGG - Intergenic
1087124658 11:94612383-94612405 GAAAAAATATTCCATGCAAATGG - Intronic
1087128355 11:94647755-94647777 GCCAAGCTATTCCCTGCATCTGG - Intergenic
1088703611 11:112438874-112438896 GAAAAAATATTCCATGCAAATGG - Intergenic
1091661552 12:2387703-2387725 GGAAAGCTGTTCCCTGCAACTGG + Intronic
1091842987 12:3633759-3633781 GCAAGACTATTCCCTGCAGTTGG - Intronic
1092555968 12:9561840-9561862 CCAAACTTATTCCTTACAACAGG + Intergenic
1093986916 12:25544400-25544422 GAAAAACTATTCCATTCAACTGG - Intronic
1094182198 12:27603874-27603896 GCAAAATTCTTCCCACCAAGGGG - Intronic
1094516128 12:31128808-31128830 CCAAACTTATTCCTTACAACAGG - Intergenic
1099569090 12:84292444-84292466 GCAAAGGTTTTCCCTACAACAGG + Intergenic
1100284402 12:93151411-93151433 GCAAAAATATACCATGCAAAAGG + Intergenic
1103115562 12:118327145-118327167 ACAAAGTTAATCCCTGCATCTGG + Intronic
1103183970 12:118940101-118940123 ACAAAAATATTCCCTGGAAGAGG - Intergenic
1103490516 12:121315097-121315119 CCAAACTTATTACCTGTAACAGG - Intronic
1106232430 13:27831217-27831239 GCATAACTATTCCCTTCAATGGG + Intergenic
1106904975 13:34396938-34396960 GAAAAAATATTCCATGCAAATGG + Intergenic
1107113729 13:36724689-36724711 GCAGAATTCTTCACTGCTACAGG - Intergenic
1107415962 13:40200358-40200380 GGAAAATTATTCCAGGCAAAAGG - Intergenic
1108157959 13:47606529-47606551 GAAAAAATATTCCATGCAACTGG + Intergenic
1108548164 13:51517207-51517229 GCAAAATCATTTTCTACAACAGG + Intergenic
1108974225 13:56417723-56417745 GCAAAATGAAGTCCTGCAACAGG + Intergenic
1110695686 13:78485572-78485594 GTAGAATTATCCCCTGCCACAGG + Intergenic
1111363538 13:87209134-87209156 GAAAAATTAGTCCCAGCTACTGG + Intergenic
1116741269 14:48758035-48758057 GCAAAAGTATTCACTTCTACCGG - Intergenic
1118504239 14:66393178-66393200 GCAAAATTCTTCTCTGCATCTGG + Intergenic
1125349711 15:38754204-38754226 GCAAAATTCTTGCCTACTACAGG - Intergenic
1126250547 15:46563064-46563086 GAAAAAATATTCCCTGCCAATGG - Intergenic
1126585012 15:50276565-50276587 TCAAAATTATTTCTTGCACCAGG + Intronic
1129419450 15:75411985-75412007 GAAAAATTCTTCCCTGTAATTGG - Intronic
1133308006 16:4823401-4823423 CCATAATTATGCCCAGCAACAGG + Intronic
1135321341 16:21499343-21499365 GGAGAATTTTTCCCTGTAACCGG + Intergenic
1135374174 16:21930845-21930867 GGAGAATTTTTCCCTGTAACCGG + Intergenic
1135437612 16:22439876-22439898 GGAGAATTTTTCCCTGTAACCGG - Intergenic
1138371074 16:56526734-56526756 CCAAAATTATACCCAGCAGCGGG - Intergenic
1146427415 17:32754818-32754840 GCAAACATATTCCATGCAAATGG + Intronic
1149101874 17:52916774-52916796 GAAAAAATATTCCATGCAAATGG - Intergenic
1150881251 17:69031095-69031117 GAAAAATTATCCCTAGCAACGGG - Intronic
1151133225 17:71920060-71920082 GCATAATTATTGTCTACAACTGG - Intergenic
1151600958 17:75105681-75105703 ACAAAAATGTTCCCTGCAGCAGG + Intronic
1152017907 17:77763990-77764012 GCAAAATAATTACATGCAAAGGG + Intergenic
1154081025 18:11257054-11257076 GGAAAATAAAGCCCTGCAACTGG - Intergenic
1156668105 18:39433082-39433104 GAAAATTTATTCCCTTCTACAGG + Intergenic
1158490800 18:57907763-57907785 GCAAAAATATACCCAGCAAGTGG - Intergenic
1159026771 18:63190306-63190328 ACAAAATGATTCCATGCCACGGG + Intronic
1159730865 18:72025825-72025847 GAAAAAATATTCCATGCAAATGG - Intergenic
1162432536 19:10637640-10637662 GCAAACTTGTTCTCTGCAGCTGG - Exonic
1163736395 19:18983846-18983868 GCAAAATAATTGCTTGAAACTGG + Intergenic
1165017612 19:32893194-32893216 AAAAAAATATTCCATGCAACTGG + Intronic
1166253868 19:41588870-41588892 GCAAAATTTTTGCATGCATCTGG + Intronic
1168472822 19:56653222-56653244 GCAAAACTAATCCATGCAAGTGG - Intronic
926409318 2:12585730-12585752 GCAAAATAATTCACTACAAATGG + Intergenic
930145652 2:48000954-48000976 GAAAAAATATTCCATGCAAATGG + Intergenic
930294619 2:49539271-49539293 GAAAAAATATTCCATGCAAATGG + Intergenic
930432610 2:51299390-51299412 ACAAAATTATTCTGTGCAAGAGG - Intergenic
931986932 2:67751281-67751303 GCAGAAGTATTCCCTAGAACAGG + Intergenic
932929895 2:76022303-76022325 GCATAAATATTACCTGCGACAGG + Intergenic
933372497 2:81433478-81433500 GCAAATTTCTTCCCTGTGACTGG + Intergenic
935156145 2:100485290-100485312 ACAAAATAATTCACTGAAACAGG + Intergenic
936066543 2:109336861-109336883 GCAGAATTCTTCACTGCACCAGG - Intronic
936840929 2:116767433-116767455 GCAAAGTTATTACCTGCATGGGG - Intergenic
937749494 2:125457614-125457636 GCAAAATCATACACTTCAACAGG + Intergenic
941126671 2:161592276-161592298 GAAAAAATATTCCATGCAAATGG - Intronic
941692703 2:168517723-168517745 GCAAAATTTTTTCTTGGAACTGG + Intronic
943102324 2:183503029-183503051 GAAAAAATATTCCATGTAACTGG - Intergenic
943476901 2:188368089-188368111 ACAAAATCATACCCTGCAGCTGG - Intronic
943522460 2:188970406-188970428 TCAAAATAATTCATTGCAACTGG - Intergenic
943866825 2:192935751-192935773 GAAAAAATATTCCTTGCAAATGG - Intergenic
946218963 2:218210114-218210136 GCAACAGTAATCCCTGAAACTGG - Intergenic
946766276 2:223044020-223044042 GCTATTTTATTCCCAGCAACTGG - Intergenic
1168730672 20:77002-77024 GGAAAAATATTCCATGCAAATGG + Intergenic
1169558490 20:6773515-6773537 GCAAAATAGTTCACTGCAAAGGG - Intronic
1169705740 20:8502773-8502795 GCAAAATTATTATCTGTAATTGG - Intronic
1170557823 20:17529767-17529789 GCAAAGATACTCACTGCAACAGG - Intronic
1173935887 20:46863977-46863999 GCAAAAGCATGCCCTGCATCTGG - Intergenic
1174315142 20:49693937-49693959 ACAAAATTAATCTCTGCACCTGG + Intronic
1174519071 20:51115844-51115866 ACAAGATTATTCCAGGCAACCGG - Intergenic
1177904070 21:26953835-26953857 CCAAAATAATTCCCTGAAATAGG + Intronic
1181665887 22:24396658-24396680 GTTAAATTATTCCCTGGAAATGG - Intronic
1182244166 22:28942146-28942168 TCAAAATTATTTCCTAAAACAGG - Intronic
1183614183 22:38932840-38932862 TCAAAATTATTCCATGCAAAGGG - Intergenic
949095239 3:77895-77917 GAAAAATTATTTCCTGTAACTGG + Intergenic
949118585 3:358399-358421 GGAAAATTATTTCCTACATCTGG - Intronic
951259675 3:20492862-20492884 GAAAAGTTATTCCATGCAAATGG - Intergenic
951436731 3:22673826-22673848 GAAAAAATATTCCATGCAAATGG - Intergenic
951803077 3:26618399-26618421 GCTAATTAATTCCCTGAAACTGG - Intergenic
958965480 3:100553416-100553438 GCAAGATAAATCCCTGCAAGTGG + Intronic
960225803 3:115167135-115167157 GCAAAATTATTTCCATCAATAGG + Intergenic
965174994 3:165320044-165320066 GAAAAATTATTCCATGCCAAGGG - Intergenic
965526823 3:169729265-169729287 GAAAAAATATTCCATGCAAATGG - Intergenic
965971503 3:174561630-174561652 GCAAAGTTGTTTGCTGCAACTGG + Intronic
970629503 4:17925104-17925126 ACACAATTATTCCATGAAACTGG + Intronic
971576626 4:28282760-28282782 GAAAAAATATTCCATGCAAATGG + Intergenic
978349307 4:107804705-107804727 GAAAAATTATTCCAGGCAAAAGG + Intergenic
978830743 4:113081561-113081583 GCAAAATTTTCCCCAGGAACTGG - Intronic
980178530 4:129376001-129376023 GGAAAATTATTGACAGCAACAGG - Intergenic
980644960 4:135632339-135632361 GGAAAATTATTCCGTGAAATAGG - Intergenic
980716292 4:136634462-136634484 ACAAAATTATTCCCAGGAAAGGG - Intergenic
982899232 4:160977453-160977475 GCAAAATTAGTCTCTGTAGCAGG + Intergenic
982903372 4:161036540-161036562 GAAAAAATATTCCCAGCAAATGG + Intergenic
984858474 4:184216213-184216235 GCAAACTGCTTCCCTGCAAGGGG + Intronic
986366134 5:7033795-7033817 AAAAAGATATTCCCTGCAACTGG + Intergenic
988005568 5:25406153-25406175 TCAGAATTACTCCCTGCCACAGG - Intergenic
994085006 5:95748869-95748891 GAAAAATTATTCTTTCCAACTGG - Intronic
995041866 5:107597402-107597424 GCAAAATTATTTCCTTCCACTGG + Intronic
995359189 5:111274681-111274703 ACCAATTTATTCCCTTCAACAGG + Intronic
996035621 5:118755463-118755485 CCAAAATTGTTCCATTCAACAGG - Intergenic
996156109 5:120103706-120103728 GAAAAAGTATTCCATGCAAAGGG - Intergenic
996409352 5:123140516-123140538 GCAAAATTATTCACTTTAAAGGG + Intronic
999423540 5:151466072-151466094 GCCAAATTATTTTCTGTAACTGG + Intronic
999773391 5:154792325-154792347 GCAAAATTATTCCCTGCAACAGG - Intronic
1000610373 5:163367112-163367134 ACAAAATTATTAACTCCAACAGG + Intergenic
1007967195 6:46014378-46014400 GCATAAATATTCCCTGGAATTGG - Intronic
1009373295 6:62936016-62936038 GAAACATTATTCCATGCAAATGG - Intergenic
1011357971 6:86492026-86492048 GCAAGACTGTTCCCTGCAAGGGG - Intergenic
1011508105 6:88069963-88069985 GAAAAAATATTCCAGGCAACTGG - Intergenic
1012056902 6:94424669-94424691 GAAAAAATATTCCATGCAAATGG - Intergenic
1016831736 6:148440897-148440919 GCAAAAATATTACCTTTAACAGG - Intronic
1020857117 7:13442753-13442775 GGAAAATTATTACCTCCAAATGG - Intergenic
1023374466 7:39542228-39542250 GAAAAAATATTCCTTGCATCAGG - Intergenic
1024505319 7:50157733-50157755 GCAAAATTATTTCAGGCCACGGG + Intronic
1024873301 7:53991258-53991280 GCAAGATAATTCCCTAAAACTGG - Intergenic
1027941163 7:84681607-84681629 GAAAAATTTTTCCCTGAAAATGG + Intergenic
1029013154 7:97283660-97283682 ACAGAATTATTCACTGTAACAGG - Intergenic
1031875145 7:127130961-127130983 ACAAAATTATTACCTGAGACTGG - Intronic
1032298031 7:130660262-130660284 GCAGACTTATTCCTTGCATCTGG + Intronic
1033369440 7:140695525-140695547 CCAAAATTAATGCCTGCAAGTGG - Intronic
1036838550 8:12095893-12095915 GGAATATTGTTCCCTTCAACAGG - Intergenic
1036860339 8:12342137-12342159 GGAATATTGTTCCCTTCAACAGG - Intergenic
1039752683 8:40492725-40492747 GAAAAATAATTCCCTTCAAAGGG + Intergenic
1041546299 8:59047148-59047170 GCAAACTAATTACATGCAACAGG + Intronic
1042654013 8:71075412-71075434 GAAAACATATTCCATGCAACTGG - Intergenic
1046656000 8:116895100-116895122 GAAAAAATATTCCATGCAACTGG + Intergenic
1050553081 9:6764807-6764829 GCCAAATTAATACCTGGAACTGG - Intronic
1051606966 9:18925888-18925910 ACAAAATTCTTCACTCCAACAGG + Intergenic
1055421613 9:76149238-76149260 GAAAAATTATTCCTTGTCACTGG - Intronic
1055650872 9:78405627-78405649 GTTAAGATATTCCCTGCAACAGG + Intergenic
1055683992 9:78750686-78750708 GAAAAAATATTCCATGCAAAGGG - Intergenic
1057822276 9:98341939-98341961 ACTAAATTATTCCCTCCACCTGG - Intronic
1058233767 9:102463347-102463369 GAAAAAATATTCCTTGCAAATGG + Intergenic
1060575491 9:124688593-124688615 GCAAGAGTATTCACTGCTACTGG + Intronic
1185501953 X:603704-603726 GCAACATTGCTCCCTGCAACTGG - Intergenic
1188222084 X:27553590-27553612 GGAAAAATATTCCATGCAAATGG - Intergenic
1188381881 X:29504672-29504694 GAAAAGATATTCCATGCAACTGG - Intronic
1194445464 X:93981915-93981937 GGAAAAATATTCCATGCAAATGG - Intergenic
1194862046 X:99011465-99011487 ACAAAGAAATTCCCTGCAACTGG - Intergenic
1196986960 X:121284372-121284394 GGAAAGTTATTCCATGCAATTGG - Intergenic
1197260803 X:124315442-124315464 AAAAAAATATTCCATGCAACTGG + Intronic
1197415976 X:126173168-126173190 GCAAAATTATCCTTTTCAACCGG - Intergenic
1199620433 X:149696213-149696235 GCAAATTTATTTCCTGGAAGAGG + Intronic
1200305083 X:155016890-155016912 GCCAAATTTTTACCTGCCACAGG - Intronic
1200758300 Y:7012712-7012734 GAAAAATGATTCCCTGGACCAGG + Intronic